phase 2 wire system small with little more than a transformer and associated

Text book of electrical technology

Text book of electrical technology

Ngày tải lên : 26/11/2014, 11:10
... supplies 120 0 A on the positive and 1000 A on the negative side The balancer machines have each an armature resistance of 0.1W and take 10 A on no-load Find (a) the voltage across each balancer and ... 53.75 + 25 × 33.75) = 2. 82 V ∴ potential of point D = 23 6 − 2. 82 = 23 3.18 V Fig 40 .22 Example 40.11 A distributor cable AB is fed at its ends A and B Loads of 12, 24 , 72 and 48 A are taken from ... and Tariffs of Electric Supply — Demand — Average Demand — Maximum Demand — Demand Factor—Diversity of Demand—Diversity Factor — Load Factor—Significance of Load Factor — Plant Factor or Capacity...
  • 454
  • 849
  • 1
RAMIFICATION OF THE GAUSS MAP AND THE TOTAL CURVATURE OF A COMPLETE MINIMAL SURFACE

RAMIFICATION OF THE GAUSS MAP AND THE TOTAL CURVATURE OF A COMPLETE MINIMAL SURFACE

Ngày tải lên : 14/10/2015, 07:57
... curves and the Gauss map of algebraic minimal surfaces, Differential Geom Appl., 25 (20 07), 701-7 12 [ 12] Y Kawakami, R Kobayashi, and R Miyaoka, The Gauss map of pseudoalgebraic minimal surfaces, ... 2 PHAM HOANG HA, LE BICH PHUONG AND PHAM DUC THOAN (see Jin-Ru [11], Kawakami-Kobayashi-Miyaoka [ 12] , Ha [9], DethloffHa [3] and Dethloff-Ha-Thoan [4] for examples) A natural question ... Ramification of the Gauss map of complete minimal surfaces in R3 and R4 on annular ends, Ann Fac Sci Toulouse Math., 23 (20 14), 829 -846 RAMIFICATION OF THE GAUSS MAP AND THE TOTAL CURVATURE 23 ...
  • 24
  • 372
  • 0
Báo cáo y học: "Monocyte surface expression of Fcγ receptor RI (CD64), a biomarker reflecting type-I interferon levels in systemic lupus erythematosus" pptx

Báo cáo y học: "Monocyte surface expression of Fcγ receptor RI (CD64), a biomarker reflecting type-I interferon levels in systemic lupus erythematosus" pptx

Ngày tải lên : 12/08/2014, 12:20
... CAG CTG TGA CAC CTC AG-3'; CD 32 forward 5'-TTC AAG GCC AAC AAC AAT GA-3', reverse 5'-GGA GAA GGT GGG ATC CAA AT-3'; CD64 forward 5'-GTG TCA TGC GTG GAA GGA TA-3', reverse 5'-GCA CTG GAG CTG GAA ... forward 5'-AGG CTG CTT TGG TTT GTG AC-3', reverse 5'-AGC AGG AGA AGC ACA TCA GC-3'; and IFI44 forward 5'-CTG GGG CTG AGT GAG AAA GA-3', reverse 5'-AGC GAT GGG GAA TCA ATG TA-3'; CXCL9 forward ... TTC TGA TTG GAG TG3', reverse 5'-TCA ATT TTC TCG CAG GAA GG-3'; CD14 forward 5'-ATT TGG TGG CAG GAG ATC AA-3', reverse 5'-GCT TCC AGG CTT CAC ACT TG-3'; CD16 forward 5'-ACA GGT GCC AGA CAA ACC...
  • 12
  • 200
  • 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

Ngày tải lên : 21/02/2014, 03:20
... brassicae CSPMbraA6 [ 32] We observed also that BrC15-Ac was able to displace ASA, suggesting that brominated fatty acid and ASA both associated with W81 in the same ligand binding site The ligand ... 5¢-GAGCCCGGATCCACCATGAA GGTCTCAATAATT 3¢; 3¢ primer, 5¢-CTGACG GAAT TCTTAAACATTAATGCC 3¢ These primers encoded a Kozak consensus sequence as well as BamHI and EcoRI restriction sites The PCR-amplified ... analysis and purification of recombinant ASP3c (A) SDS/PAGE analysis of recombinant ASP3c secreted by Pichia pastoris Lane shows standards (Low range and Polypeptide kits, Bio-Rad, France) and lanes 2 5...
  • 11
  • 642
  • 0
Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx

Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx

Ngày tải lên : 22/02/2014, 02:20
... finegrained and reliable automatic evaluation metrics for realisation ranking The system presented by Cahill et al (20 07) ranks the strings generated by a hand-crafted broad-coverage Lexical Functional ... data Belz and Reiter (20 06) carry out a comparison of automatic evaluation metrics against human domain experts and human non-experts in the domain of weather forecast statements In their evaluations, ... reversible, i.e the same grammar is used for parsing as for generation It is a hand-crafted grammar, and has been carefully constructed to only parse (and therefore generate) grammatical strings.3 (1)...
  • 9
  • 479
  • 0
Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx

Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx

Ngày tải lên : 22/02/2014, 04:20
... 5¢-AGTTTCAGGGTCAACAACCCTG-3¢ 5¢-CTCGAATTCATGACAACGGTAGCTGCTTCTC-3¢ 5¢-CTCGGATCCATGGCTGATGATGGAAGCAG-3¢ 5¢-TCAGCGTCACCGTTATCCTC-3¢ 5¢-GTGAGAAATGGAGATGCTGC-3¢ 5¢-TGTTCCGGAGAGCCTCCTC-3¢ 5¢-CAACGGAAGCACGCATAGGAGCAC-3¢ ... 5¢-GTTGCGTAGGACGAGCAT-3¢ 5¢-CGGATGCCGATTTTGTGGAGG-3¢ 5¢-GCTGGTACCGCACCTTCTCCACAAG-3¢ 5¢-TCYGGRTCRTTNAGRTADCCTTTCAT-3¢ 5¢-TBACNCARTCNGCNTAYGTBGARAA-3¢ 5¢-GTTCTAAGCTTTTAAGGCGTCTGAGTGGC-3¢ 5¢-AGTTTCAGGGTCAACAACCCTG-3¢ ... sequence alignment (GenBank accession numbers given in parentheses): Arabidopsis thaliana 4CL1 (U18675), A thaliana 4CL2 (AF106086), A thaliana 4CL3 (AF106088), G max 4CL1 (AF27 926 7), G max 4CL2 (AF0 022 59),...
  • 12
  • 448
  • 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Ngày tải lên : 07/03/2014, 16:20
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP _2: AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP _2: ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP _2: AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... 23 2 88 CLAP_1:ATTTAAAAGAATTCCCGAATGGGCCAAGGATCTTCCATTGAAAGAAGTTTTGAGGTATCACATTGCAAGAGGGTTGTATTATGATAAAGATCTCCAGAAT CLAP _2: ATTTAAAAGAATTCCCGAATGGGCCAAGGATCTTCCATTGAAAGAAGTTTTGAGGTATCACATTGCAAGAGGGTTGTATTATGATAAAGATCTCCAGAAT...
  • 12
  • 772
  • 0
Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot

Ngày tải lên : 08/03/2014, 08:20
... 20 0 (Amersham) prepacked column (3 .2 · 300 mm), calibrated with RNAase A (molecular mass 13.7 kDa), chymotrypsinogen A (25 .0 kDa), ovalbumin (45.0 kDa), BSA (67.0 kDa), and Blue Dextran 2, 000, ... several plants, an accumulation of methylated flavonoids has been explained as a protection against pathogens, predators and ultraviolet radiation [2] A recent investigation concerning the pathogenic ... of each reaction mixture, after their chromatographic separation and purification, were submitted to 1H NMR (nuclear magnetic resonance) and FABMS (fast atom bombardment mass spectrum) analyses...
  • 10
  • 624
  • 0
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

Ngày tải lên : 16/03/2014, 14:20
... Journal 27 3 (20 06) 27 22 27 29 ª 20 06 The Authors Journal compilation ª 20 06 FEBS R Machielsen and J van der Oost 14 Higashi N, Matsuura T, Nakagawa A & Ishikawa K (20 05) Crystallization and preliminary ... furiosus using the primers BG 127 9 (5¢-GCGCG CCATGGCATCCGAGAAGATGGTTGCTATCA, sense) and BG 129 7 (5¢-GCGCGGGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense), containing NcoI and BamHI sites (underlined in ... L-Glycerate 3-Hydroxybutyrate Lactate Butane -2, 3-diol Butane-1,3-diol Butane-1 ,2- diol Butan-1-ol Butan -2- ol Propane-1 ,2- diol Glycerol FEBS Journal 27 3 (20 06) 27 22 27 29 ª 20 06 The Authors Journal compilation...
  • 8
  • 415
  • 0
Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

Ngày tải lên : 17/03/2014, 09:20
... concentration of MMOB Ó FEBS 20 03 5 42 Y Astier et al (Eur J Biochem 27 0) catalase and the electrode was held at a negative potential for 30 to enable any oxidation products to accumulate (as described ... Methylococcus capsulatus (Bath) Eur J Biochem 24 1, 5 52 556 Gallagher, S.C., Callaghan, A. J., Zhao, J., Dalton, H & Trewhella, J (1999) Global conformational changes control the reactivity of methane monooxygenase ... effect of increasing catalase concentrations (0, 2. 4, 4.8 and 7 .2 lM, respectively) The effect of ventilating the reaction at the highest catalase concentration was also investigated as shown strongly...
  • 6
  • 464
  • 0
Báo cáo " Research, design and fabrication of a high-power combiner using Wilkinson bridge of L-band " pptx

Báo cáo " Research, design and fabrication of a high-power combiner using Wilkinson bridge of L-band " pptx

Ngày tải lên : 22/03/2014, 11:20
... Van Thanh, Nguyen Anh Tuan, Bach Gia Duong, Research, Design And Fabrication Of The 45W And The 20 0W, L-Band Power Amplifier Using The Modern Microstrip Technology For Application In The National ... Figure 2b, 2c The 1030 MHz frequency was studied because this frequency will application in our the next reseach for design and fabrication of a transmitter system for the phase identification ... we revealed that the bandwidth was quite wide and the amplifying coefficient has achieved the high value within the frequency range 905MHz-1060MHz (Fig 6a) [4] The signal at 1030 MHz was inputed...
  • 5
  • 374
  • 0
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

Ngày tải lên : 23/03/2014, 04:21
... plasmid The gene was amplified from this plasmid by PCR using forward primer 5¢-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACTTATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3¢ ... for bB2 using forward primer 5¢-ACTTATACTACTCATATGCTCAACCC CAAGATCATC-3¢ and reverse primer 5¢-ACTTATAC TATCCTCGAGCCACTGCATGTCCCGG-3¢, to produce an amplicon lacking the N- and C-terminal extensions ... produce affinity-tagged cB and bB2 clones of lengths equivalent to each other and to Gambeta We amplified the cDNA for cB using forward primer 5¢-ACTTATACTACTCATATGGGGAAGATCACTTTTT ACG-3¢ and reverse...
  • 13
  • 430
  • 0
Báo cáo khoa học: Inhibitory properties and solution structure of a potent Bowman–Birk protease inhibitor from lentil (Lens culinaris, L) seeds ppt

Báo cáo khoa học: Inhibitory properties and solution structure of a potent Bowman–Birk protease inhibitor from lentil (Lens culinaris, L) seeds ppt

Ngày tải lên : 23/03/2014, 10:21
... 800 ã 20 48 spectra were acquired using time proportional phase increments [53] and transformed to a nal 2K ã 2K real data matrix after apodization with a 90 and 60-shifted sine-bell squared function ... 0.90 A 1.63 A 1.08 1.88 0. 62 0.64 A A A A Ramachandran plot statistics Amino Amino Amino Amino acids acids acids acids in in in in most favoured region allowed region generously allowed ... independently found equal to 135 min)1 and to 3.85 min)1 and KM values of 125 0 lm and 850 lm for BApNA and GPpNA, respectively, by means of standard LineweaverBurk analysis of initial rate kinetics Fitting...
  • 16
  • 518
  • 0
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx

Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx

Ngày tải lên : 23/03/2014, 13:20
... performed MALDI MS analysis of all five peaks eluted at the beginning of the chromatogram (peaks 1*, 2* , 3*, and in Fig 5A) For peaks and 2, molecular masses of 20 25 and 20 41 Da were obtained as before ... demonstrated by fiber X-ray diffraction analysis [33], and, as shown by Falconi et al [31], water hydration sites are mainly located around protein cavities and clefts Raman optical activity spectra also ... N-(4-methylcoumarin-7-yl) glycamines: synthesis, characterization and use in carbohydrate analysis Bioorg Khimiya (Russia) 12, 120 3– 121 2 23 Tsugita, A & Scheffler, J.J (19 82) A rapid method for acid hydrolysis...
  • 10
  • 398
  • 0
Báo cáo khoa học: "Correlating Human and Automatic Evaluation of a German Surface Realiser" doc

Báo cáo khoa học: "Correlating Human and Automatic Evaluation of a German Surface Realiser" doc

Ngày tải lên : 23/03/2014, 17:20
... NAACL-03, pages 61–63, NJ, USA Karolina Owczarzak, Josef van Genabith, and Andy Way 20 08 Evaluating machine translation with LFG dependencies Machine Translation, 21 :95– 119 Karolina Owczarzak ... pages 22 3 23 1 Anja Belz and Ehud Reiter 20 06 Comparing automatic and human evaluation of NLG systems In Proceedings of EACL 20 06, pages 313– 320 , Trento, Italy Amanda Stent, Matthew Marge, and Mohit ... retraining the MALT dependency parser with our data set Ehud Reiter and Anja Belz 20 09 An Investigation into the Validity of Some Metrics for Automatically Evaluating Natural Language Generation...
  • 4
  • 285
  • 0
Báo cáo khoa học: A DNA-binding surface of SPO11-1, an Arabidopsis SPO11 orthologue required for normal meiosis docx

Báo cáo khoa học: A DNA-binding surface of SPO11-1, an Arabidopsis SPO11 orthologue required for normal meiosis docx

Ngày tải lên : 29/03/2014, 09:20
... G215E, R 222 E, R 223 E and R 226 E) observed in vitro was not the result of a global change in the net charge (i.e basic or neutral to acidic) of the mutant proteins Thus, Gly215, Arg 222 , Arg 223 and ... R207E and R254E,  0.8 lm for G215E and R 226 E and much larger than 0.8 lm (generally estimated to be  1.5 lm) for R 222 E and R 223 E These results revealed that the reduced DNA binding of mutant ... [8–13] and Arabidopsis thaliana [14,15] Yeast, flies, nematodes and mammals encode a single SPO11; however, plants (e.g Arabidopsis and rice Oryza sativa) encode at least three SPO11 paralogues...
  • 15
  • 393
  • 0
Báo cáo Y học: A single charged surface residue modifies the activity of ikitoxin, a beta-type Na+ channel toxin from Parabuthus transvaalicus doc

Báo cáo Y học: A single charged surface residue modifies the activity of ikitoxin, a beta-type Na+ channel toxin from Parabuthus transvaalicus doc

Ngày tải lên : 31/03/2014, 08:20
... measurable inward current after steady-state blockade by TTX B and D show that Na+ current reaches peak amplitude approximately 0.3 ms after the beginning of each depolarization, and that the amplitude ... Environmental Health Sciences Center, P30 ESO5707, NIH grant EY08 120 (to ATI) and NEI Core Grant P30 EY 125 76 A B Inceoglu is partially funded by Ankara University Y Hayashida and A T Ishida thank Dr B ... transvaalicus (Buthidae) Eur J Biochem 26 8, 5407–5413 Hidaka, S & Ishida, A. T (1998) Voltage-gated Na+ current availability after step- and spike-shaped conditioning depolarizations of retinal ganglion...
  • 8
  • 425
  • 0
improving near field confinement of a bowtie aperture using surface plasmon polaritons

improving near field confinement of a bowtie aperture using surface plasmon polaritons

Ngày tải lên : 06/05/2014, 08:53
... Park, and B Lee, Appl Phys Lett 92, 013103 20 08͒ 10 H J Lezec, A Degiron, E Devaux, R A Linke, L Martin-Moreno, F J Garcia-Vidal, and T W Ebbesen, Science 29 7, 820 20 02 11 F J Garc a- Vidal, ... modulation when the wave propagates to and reflects from the groove A close examination of Fig 2 b͒ indicates that SPP waves are excited at the edges of each groove and stronger fields are located at ... 22 3106 -2 Appl Phys Lett 98, 22 3106 20 11͒ Srisungsitthisunti, Ersoy, and Xu (a) (b) Air Air Al Al E E Quartz Quartz Normalized FWHM 3.5 (c) Distance (z) 10nm 30nm 50nm 2. 5 1.5 0.5 100 20 0...
  • 3
  • 347
  • 0
Báo cáo toán học: " Spin-related tunneling through a nanostructured electric-magnetic barrier on the surface of a topological insulator" potx

Báo cáo toán học: " Spin-related tunneling through a nanostructured electric-magnetic barrier on the surface of a topological insulator" potx

Ngày tải lên : 20/06/2014, 20:20
... and magnetic potential barrier on the surface of a 3D topological insulator, as shown in Figure We can create magnetic and electric potentials underneath a superconducting plate and a ferromagnetic ... Topological insulators in Bi2 Se3 , Bi2 T e3 and Sb2 T e3 with a single Dirac cone on the surface Nat Phys 20 09, 5:438 [9] Hsieh D, Qian D, Wray L, Xia Y, Hor YS, Cava RJ, Hasan MZ: A topological Dirac ... above can be examined by the measurable quantities, the conductance G, and Fano factor F [20 , 21 ] The ballistic conductance and Fano factor for a given Fermi energy at zero temperature are given...
  • 18
  • 404
  • 0
Báo cáo hóa học: " Research Article Convergence Analysis of a Mixed Controlled l2 − l p Adaptive Algorithm" potx

Báo cáo hóa học: " Research Article Convergence Analysis of a Mixed Controlled l2 − l p Adaptive Algorithm" potx

Ngày tải lên : 21/06/2014, 08:20
... simulation EMSE for p = 4, α = 0.8 Gaussian Laplacian Uniform Theoretical Simulation Theoretical Simulation Theoretical 22 .47 22 .6 −14 .26 −16. 02 27 .65 26 .59 28 .7 28 .64 26 .41 26 . 32 29 .15 ... example, these are quite similar to what is usually assumed in the literature [14, 15, 20 22 ], and which can also be justified in several practical instances (A1 ) The input signal xn is zero mean ... 29 .15 29 .57 −39 .28 dB 10 dB 20 dB −39.87 −39 .24 −39.58 −39 .28 −39. 92 0 −5 −5 Laplacian Gaussian Uniform −15 20 Laplacian Gaussian Uniform −10 EMSE (dB) −10 EMSE (dB) Simulation −15 20 25 25 ...
  • 10
  • 426
  • 0

Xem thêm