pass 2d array to function in c

Báo cáo Y học: Dystrobrevin requires a dystrophin-binding domain to function in Caenorhabditis elegans doc

Báo cáo Y học: Dystrobrevin requires a dystrophin-binding domain to function in Caenorhabditis elegans doc

Ngày tải lên : 08/03/2014, 23:20
... involved in the interaction with Dys-1 in vitro Within this domain, the first half seems to be particularly critical as deletions infringing on this side lead to a decrease in binding Constructs ... transformed in Escherichia coli DH5 Clones were picked randomly and analysed using sequencing procedures Any clones carrying a frame shift were rejected Construct 6¢4 was built using similar procedures, ... amino acids (Fig 5), rescue of dyb-1(cx36) animals still occurred in two out of three lines transgenic lines (Table 1), which indicates that removing introns and did not impair the rescuing capacity...
  • 6
  • 334
  • 0
Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

Ngày tải lên : 18/02/2014, 16:20
... Metabolic gene switching in murine female heart function [8] Likewise, high fatty acid oxidation rates in the diabetic heart results in reduced cardiac efficiency [9] In addition to its cytoplasmic ... (2001) Intrinsic diurnal variations in cardiac metabolism and contractile function Circ Res 89, 1199–1208 19 Sordahl LA, Besch HR Jr, Allen JC, Crow C, Lindenmayer GE & Schwartz A (1971) Enzymatic ... Sack MN (2004) Hypoxia-induced decrease 5284 of UCP3 gene expression in rat heart parallels metabolic gene switching but fails to affect mitochondrial respiratory coupling Biochem Biophys Res Commun...
  • 7
  • 582
  • 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Ngày tải lên : 18/06/2014, 16:20
... exposing CD4+ T cells to both IL-2 and rapamycin in vitro leads to an increase in the cellular frequency of FOXP3+ T cells, originating from nTreg cells and de novo induced Treg cells [91] Clinical ... apoptosis due to a deficiency of IL-2 in inflammatory sites [10] Hence, IL-2 may function as critical an anti-apoptotic factor for Treg cells Evidence of Treg deficiencies in human T1 D It is unclear ... including CD4+ regulatory T cells (T reg) cells [2] These cells constitute 1-10% of * Correspondence: ciro.piccirillo@mcgill.ca † Contributed equally FOCIS Center of Excellence, Research Institute...
  • 12
  • 573
  • 0
báo cáo hóa học: " A prospective study of decline in lung function in relation to welding emissions" pdf

báo cáo hóa học: " A prospective study of decline in lung function in relation to welding emissions" pdf

Ngày tải lên : 20/06/2014, 00:20
... http://www.occup-med.com/content/3/1/6 atory volume in one second (FEV1) and forced expiratory capacity (FVC) were recorded in accordance with American Thoracic Society guidelines (24) Lung function data ... we examined exposure-response relations between the acumulated exposures during followup according to the specific welding technology We also examined decline in lung function according to exposure ... decline in lung function according to our Table 3: Full shift average exposure to welding fume particulates measured in air samples collected among 44 randomly selected welders in 1987 in comparison...
  • 8
  • 437
  • 0
báo cáo hóa học:" Revision of failed hip resurfacing to total hip arthroplasty rapidly relieves pain and improves function in the early post operative period" pdf

báo cáo hóa học:" Revision of failed hip resurfacing to total hip arthroplasty rapidly relieves pain and improves function in the early post operative period" pdf

Ngày tải lên : 20/06/2014, 04:20
... pain and inability to return to normal activity Figure A comminuted complex intertrochanteric fracture occurring due to the patient falling from his bicycle The acetabular component was retained ... logical to avoid cobalt chrome components in the bearing couple when revising for this indication While it is too early to comment on the clinical outcomes of these prostheses, the main determinants ... occupational work Active Regularly participates in active events such as bicycling, aqua-aerobics Gardening or working out in the gym once or twice a week Very active: Regularly participates in...
  • 6
  • 305
  • 0
báo cáo hóa học:" Revision of failed hip resurfacing to total hip arthroplasty rapidly relieves pain and improves function in the early post operative period" pptx

báo cáo hóa học:" Revision of failed hip resurfacing to total hip arthroplasty rapidly relieves pain and improves function in the early post operative period" pptx

Ngày tải lên : 20/06/2014, 07:20
... pain and inability to return to normal activity Figure A comminuted complex intertrochanteric fracture occurring due to the patient falling from his bicycle The acetabular component was retained ... logical to avoid cobalt chrome components in the bearing couple when revising for this indication While it is too early to comment on the clinical outcomes of these prostheses, the main determinants ... occupational work Active Regularly participates in active events such as bicycling, aqua-aerobics Gardening or working out in the gym once or twice a week Very active: Regularly participates in...
  • 6
  • 359
  • 0
Báo cáo khoa học: "Relationship of cognitive function in patients with schizophrenia in remission to disability: a cross-sectional study in an Indian sample" pps

Báo cáo khoa học: "Relationship of cognitive function in patients with schizophrenia in remission to disability: a cross-sectional study in an Indian sample" pps

Ngày tải lên : 08/08/2014, 23:20
... contributed to recruiting patients, confirming the diagnosis and interpretation of results References Sharma T, Antonova L: Cognitive function in schizophrenia Deficits, functional consequences, ... Psychological Corporation; 1990 Mukundan CR: NIMHANS neuropsychological battery: test descriptions, instructions, clinical data and interpretation In Proceedings of the National Workshop in Clinical ... evidence to suggest that older patients with schizophrenia (>65) show a progressive decline in cognitive functioning compared to younger patients [30] Symptomatology and functional outcome Previous...
  • 8
  • 397
  • 0
Báo cáo y học: " Alterations in hippocampal serotonergic and INSR function in streptozotocin induced diabetic rats exposed to stress: neuroprotective role of pyridoxine and Aegle marmelose" doc

Báo cáo y học: " Alterations in hippocampal serotonergic and INSR function in streptozotocin induced diabetic rats exposed to stress: neuroprotective role of pyridoxine and Aegle marmelose" doc

Ngày tải lên : 10/08/2014, 05:21
... learning occur in association with distinct changes in hippocampal synaptic plasticity due to defects in insulin action in the brain [42] Treatment with insulin therefore not only corrects hyperglycaemia, ... Paulose CS: Serotonergic receptor functional up regulation in cerebral cortex and down regulation in brain stem of Streptozotocin induced Diabetic Rats: Antagonism by pyridoxine and insulin Neuroscience ... http://www.jbiomedsci.com/content/17/1/78 Page 11 of 15 c c a c c c d c a Figure Representative graph showing behavioural response in streptozotocin induced diabetic Rats: Effects of insulin and pyridoxine...
  • 15
  • 355
  • 0
Báo cáo khoa học: "Cystatin C: unsuited to use as a marker of kidney function in the intensive care unit" pot

Báo cáo khoa học: "Cystatin C: unsuited to use as a marker of kidney function in the intensive care unit" pot

Ngày tải lên : 12/08/2014, 22:21
... author(s) declare that they have no competing interests References 532 Villa P, Jiménez M, Soriano MC, Manzanares J, Casasnovas P: Serum cystatin C as a marker of acute renal dysfunction in critically ... Domanetzki M, Zinck R, Schumann G, Byrd D, Brodehl J: Cystatin C serum concentrations underestimate glomerular filtration rate in renal transplant recipients Clin Chem 1999, 49:1866-1868 Coll E, Botey ... older patients Ann Clin Biochem 2003, 40:648-655 Den Hollander JG, Wulkan RW, Mantel MJ, Berghout A Is cystatin C a marker of glomerular filtration rate in thyroid dysfunction? Clin Chem 2003, 49:1558-1559...
  • 2
  • 297
  • 0
Báo cáo y học: " Identification of two distinct structural regions in a human porcine endogenous retrovirus receptor, HuPAR2, contributing to function for viral entry" docx

Báo cáo y học: " Identification of two distinct structural regions in a human porcine endogenous retrovirus receptor, HuPAR2, contributing to function for viral entry" docx

Ngày tải lên : 13/08/2014, 05:21
... 5'-CCAGCTTTGGGCTGAATGGAACAAAAACTTATTTCTGAAGAA GATCTGATGGCAGCACCCACG 3' and 5'-CGTGGGTGCTGCCATCAGATCTTCT TCAGAAATAAGTTT TTGTTCCATTCAGCCCAAAGCTGG-3' MuPAR regions were introduced into the c- myc HuPAR2 or HuPAR2eGFP backbone ... and 5'-GACCCAGGAAGAAAGACCGTAAG-3' (reverse); HuPAR2 probe, 5'-FAM TTCCTGAGCCACCTGCCACCTCCT BHQ3' Final reaction concentrations were 200 nM probe and 300 nM primers in 20 μl total reaction volume ... 5'-FAM TTCTTGAGCCACCTGCCACCTCGC BHQ-3' Underlined nucleotides represent differences between HuPAR1 and HuPAR2 in this region HuPAR2 primers and probe used were 5'-GCCTGTTGTACCTCTAATGTCACT-3' (forward)...
  • 15
  • 330
  • 0
Báo cáo y học: " Bench-to-bedside review: Diaphragm muscle function in disuse and acute high-dose corticosteroid treatment" ppsx

Báo cáo y học: " Bench-to-bedside review: Diaphragm muscle function in disuse and acute high-dose corticosteroid treatment" ppsx

Ngày tải lên : 13/08/2014, 18:22
... prevented CMV-induced reduction in glutathione Furthermore, apocynin not only suppressed calpain-1 and caspase-3 activation, but in fact increased calpastatin, an endogenous calpain inhibitor Among ... myosin to actin [36] Caspases (endoproteases responsible for the final execution of cell death) including caspase-3 proteases induce DNA fragmentation, induce myonuclear apoptosis, and cleave actomyosin ... KG, Manfrin GM, Friedrich C, Deheinzelin D: Inspiratory muscle training is ineffective in mechanically ventilated critically ill patients Clinics 2005, 60: 479-484 45 Amaya-Villar R, Garnacho-Montero...
  • 9
  • 324
  • 0
Intra cellular endoplasmic reticulum dynamics, distribution and function in response to cell engineered surface adhesion

Intra cellular endoplasmic reticulum dynamics, distribution and function in response to cell engineered surface adhesion

Ngày tải lên : 11/09/2015, 09:02
... talin Integrin with α and β subunits vinculin actin Intra-cellular α-actinin talin FAK α- paxillin a cti actinin vinculin PLC, Rac1, RhoA… Figure Integrin-fibronectin interaction induced integrin ... filaments interact with integrins indirectly via adaptor proteins talin, α-actinin and vinculin Red lines indicate the direct binding of talin and α-actinin with integrin; green lines indicate the binding ... binding of talin, α-actinin and vinculin with actin filaments; and blue lines indicate the binding of vinculin with talin and α-actinin The indirect interacts provide connection between actin...
  • 163
  • 269
  • 0
 Báo cáo y học: " High blood pressure, antihypertensive medication and lung function in a general adult population"

Báo cáo y học: " High blood pressure, antihypertensive medication and lung function in a general adult population"

Ngày tải lên : 25/10/2012, 10:45
... (ATC code C0 3), beta-blocker (ATC code C0 7), calcium antagonists (ATC code C0 8), ACE inhibitors and angiotensin antagonists (ATC code C0 9) Finally, the following classes of high blood pressure ... forced expiratory volume in one second; FVC: forced vital capacity *Medication: antihypertensive medication; $% predicted values according to Quanjer; #Obtained from the chi-square test when comparing ... ethics committee of the Bavarian Chamber of Physicians, Munich Outcome assessment Lung function Lung function examinations, i.e spirometry, were conducted based on the American Thoracic Society...
  • 8
  • 579
  • 1
Báo cáo khoa học: "Medical emergency teams: deciphering clues to crises in hospitals"

Báo cáo khoa học: "Medical emergency teams: deciphering clues to crises in hospitals"

Ngày tải lên : 25/10/2012, 10:45
... authors corroborate these findings, then the inescapable conclusion will be that hospitals not reliably find patients in crisis, which is an obviously dangerous situation To respond to this finding, ... – it is a process to save reliably those patients who are in crisis Our challenge is to create an around-the-clock system that efficiently finds deteriorating patients Competing interests The ... author(s) declare that they have no competing interests References Franklin C, Mathew J: Developing strategies to prevent in- hospital cardiac arrest: analyzing responses of physicians and nurses in the...
  • 2
  • 441
  • 0
Báo cáo y học: " Factors affecting the long-term response to tacrolimus in renal transplant patients: Pharmacokinetic and pharmacogenetic approac"

Báo cáo y học: " Factors affecting the long-term response to tacrolimus in renal transplant patients: Pharmacokinetic and pharmacogenetic approac"

Ngày tải lên : 26/10/2012, 09:32
... hospital and informed consent was obtained from all subjects Maintenance treatment scheme consisted of a combination of a calcineurin inhibitor (tacrolimus) with a purine inhibitor (mycophenolate ... this empirical treatment algorithm http://www.medsci.org Int J Med Sci 2010, carries increased risk of side effects or insufficient treatment Taking into account the critical clinical condition ... Hesselink DA, van Schaik RH, van der Heiden IP, et al Genetic polymorphisms of the CYP3A4, CYP3A5, and MDR-1 genes and pharmacokinetics of the calcineurin inhibitors cyclosporine and tacrolimus Clin...
  • 7
  • 785
  • 0
An investigation into some types of verbal responses to questions in English and Vietnamese conversation

An investigation into some types of verbal responses to questions in English and Vietnamese conversation

Ngày tải lên : 07/11/2012, 14:54
... disagreement In fact, communicative problems involving the nontranslatability of the illocutionary force of an utterance are particularly noticeable in the use of indirect speech acts According to Yule ... where contextual variables can be controlled It is a good way to gain insight into social factors that are likely to affect speech and performance Cohen (1995, p.25) concedes that Discourse Completion ... social encounters For example, a teacher talking to a student in a classroom is one kind of interaction Others include a boss talking to his assistant at the workplace, a doctor to patient in...
  • 42
  • 1.1K
  • 4
Tài liệu mở rộng quản trị mạng Download IOS to C2600 in Rommon

Tài liệu mở rộng quản trị mạng Download IOS to C2600 in Rommon

Ngày tải lên : 13/11/2012, 11:22
... Cisco − How to Download a Software Image to a Cisco 2600 via TFTP Using the tftpdnld ROMmon Command Table of Contents How to Download a Software Image to a Cisco 2600 via TFTP Using the ... conventions, see the Cisco Technical Tips Conventions Prerequisites There are no specific prerequisites for this document Components Used This document is not restricted to specific software and hardware ... File reception completed Copying file c2 600−is−mz.113−2.0.3.Q to flash Erasing flash at 0x60 7c0 000 program flash location 0x60440000 rommon 22 > Related Information • Technical Support − Cisco Systems...
  • 5
  • 529
  • 0
the bilateral and multilateral commitment that Viet Nam made to participate in WTO.

the bilateral and multilateral commitment that Viet Nam made to participate in WTO.

Ngày tải lên : 12/04/2013, 22:00
... establishing a 100 per cent foreign-invested finance company, a joint-venture finance company, a 100 per cent foreign-invested financial leasing company or a joint-venture financial leasing company ... for a joint-venture finance company, a 100 per cent foreign-invested finance company, a joint-venture financial leasing company, and a 100 per cent foreign-invested financial leasing company, ... of telecommunications services providers to access and use each other's public telecommunications transport networks, non-discrimination in granting access to and use of public telecommunications...
  • 26
  • 478
  • 0
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY

USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY

Ngày tải lên : 13/04/2013, 10:29
... Director Director Assistant Director Assistant Vice Director Vice Director Production Production (96 prs.) (96 prs.) Purchasing Purchasing (5 prs.) (5 prs.) Vice Director Vice Director Planning ... The Company uses growth strategy for its core businesses In particular, it plans to construct a new factory in Hung Yen province to catch up with the increasing demand in electric wires and cables ... existing in existing Product Class Product Class Stretching Stretching Down Down Brand Brand Extensions Extensions in in different Product different Product Class Class Stretching Stretching Up...
  • 67
  • 974
  • 0
Comparing the cultural and linguistic analysis of the English word “meal” and words relating to it in contrast with Vietnamese equivalents.

Comparing the cultural and linguistic analysis of the English word “meal” and words relating to it in contrast with Vietnamese equivalents.

Ngày tải lên : 15/04/2013, 15:11
... use chopsticks in general and flexible ways to perform various functions picking foods, pushing rice into mouth, tearing, cutting, mixing, scraping and extending the arm to reach food at distance ... tray, chopsticks are often divided into two kinds: round long chopsticks, used for eating, called đũa ăn c m (individual chopsicks) and big flat chopsticks, used in stirring and serving rice including ... 3.2.2 Alcohol/wine Both alcohol and wine are excited drinks in which alcohol (in full ethyl alcohol) is a colourless volatile inflammable liquid forming the intoxicating element in wine, beer,...
  • 54
  • 1K
  • 1

Xem thêm