par 1 by stab wound injury is ablated by the deletion of il 1r1 fig
báo cáo hóa học: " Secretory PLA2-IIA: a new inflammatory factor for Alzheimer''''s disease" pot
... http://www.jneuroinflammation.com/content/3 /1/ 28 Table 1: Postmortem human brains used in the study of sPLA2-IIA expression Cases Clinical Diagnosis Gender Age (years) PMI (hours) Type of Study Brain Region 10 11 12 13 14 15 ND ND ... astrocytes with A 1 42 and IL -1 When A 1 42 and IL -1 were given together, there was no further enhancement of sPLA2-IIA mRNA expression, compared to each treatment alone Discussion In this study, we ... 11 (page number not for citation purposes) Journal of Neuroinflammation 2006, 3:28 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Akama KT, Albanese C, Pestell RG, Van Eldik...
- 11
- 389
- 0
báo cáo khoa học: "Application of in situ reverse trancriptase-polymerase chain reaction (RT-PCR) to tissue microarrays" pot
... significant synthesis of non-specific artifacts Diffusion of reaction products away from the site of synthesis, another problem associated with in situ PCR [12 ], was reduced by this rapid procedure ... were visualised by light microscopy at 40× magnification Discussion The use of in situ RT-PCR to examine gene expression in disease tissues has certain advantages over more established hybridisation, ... quality of paraffin-embedded tissue sections, and the number of steps involved in in situ PCR and the time taken to acquire data on significant numbers of samples affect the reproducibility of the...
- 5
- 254
- 0
Phát hiện và phân biệt chủng virus gây hội chứng rối loạn sinh sản và hô hấp ở lợn bằng phương pháp multiplex RT PCR (reverse transcription polymerase chain reaction)
... CT2 012 .C1 Can Tho - 2 012 JQ860 414 10 CT2 012 .C2 Can Tho - 2 012 JQ860 415 11 DT2 012 .DT7 Dong Thap - 2 012 JQ860 419 12 DT2 012 .DT8 Dong Thap - 2 012 JQ860420 13 DT2 012 .DT9 Dong Thap - 2 012 JQ8604 21 14 07QN ... - 2009 GU168567 15 JXA1-P10 Trung Quốc - 2009 FJ548854 16 DC.CH2 010 Trung Quốc - 2 010 JF748 718 17 YN-CH2 011 Trung Quốc - 2 011 JX857698 18 SD16-CH2 012 Trung Quốc - 2 012 JX087437 19 JXA1-R vaccine ... 2 012 - HG2 012 .RV1 Hau Giang - 2 012 JQ860422 HG2 012 .RV2 Hau Giang - 2 012 JQ860423 CT2 012 .HS1 Can Tho - 2 012 JQ860 416 CT2 012 .HS2 Can Tho - 2 012 JQ860 417 CT2 012 .HS3 Can Tho - 2 012 JQ860 418 CT2 012 .C1...
- 79
- 522
- 0
Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction
... Palese P (2007), “A Single Mutation in the PB1-F2 of H5N1 (HK/97) and 19 18 Influenza A Viruses Contributes to Increased Virulence”, PLoS Pathog, 3 (10 ), pp 14 14- 21 18 De Jong MD, Bach VC, Phan TQ, Vo ... USA, 10 3, pp 2845- 50 15 Chen, H., G Deng, Z Li, G Tian, Y Li, and P Jiao (2004), The evolution of H5N1 influenza viruses in ducks in southern China”, Proc Natl Acad Sci USA, 10 1: p 10 452 -10 457 ... Sinh học 2 (1) : 1- 18 Lê Văn Năm (2004), “Bệnh cúm gà”, Tạp chí Khoa học Kỹ thuật Thú y, 11 (1) : 81- 86 Tô Long Thành (2004), “Bệnh cúm loài chim”, Tạp chí Khoa học Kỹ thuật Thú y, 11 (2): 53-58...
- 11
- 581
- 0
Báo cáo khoa học: "TaqMan reverse transcription polymerase chain reaction for the detection of Japanese encephalitis virus" pot
... Virus dilution 10 0 10 1 10−2 10 −3 10 −4 10 −5 10 −6 10 −7 control Infectivity titer equivalent of JEV RNA extraction In isolated RNA* In cDNA synthesis** Real-time RT-PCR RT-PCR 1, 123,682 11 2,368 11 ,236 ... dilutions (10 1 to 10 −7) of RNA molecules prepared from isolate KV1899 to assess quantification assay JEV RNA concentration of infectivity equivalent was from 1. 1 × 10 6.0 TCID50/ml to 1. 1 TICD50/ml Fig ... 6Fam-CCCGTGGAAACAACATCATGCGGC-Tamra 10 ,726 -10 ,750 10 ,848 -10 ,8 71 10,754 -10 ,777 3' NTR 14 6 bp *Nucleotide sequence position according to KV1899 strain of JEV (GenBank accession number AY 316 157) TaqMan RT-PCR for the detection of...
- 7
- 334
- 1
Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps
... )10 .0( )10 .0( )10 .0( )10 .0( )10 .0()00.0()20.0(- + + + 17 6.0 §± 49 .13 220 .1 ± 92.72 296 .1 ± 15 .42 372.2 ± 98.02 055.0 ± 48. 71 985.0 ± 67. 31 evitageN lm/ DICT 01 lm/ DICT 01 lm/ DICT 01 lm/ DICT 01 lm/ ... llec ,CC ;noisnepsus lailehtipe :SE* † + + + + + + + + + + + + - 61 52 12 51 42 62 22 81 81 51 32 61 61 81 51 52 32 SE SE SE FV SE FV SE FV FV FV SE FV FV SE FV CC SE 5IY 41Y 3IY 1SA 7IY 2YB ... fo sisylanA † elba T VDVS :11 ;yesreJ weN VSV : 01 ;anaidnI VSV :9 ;VDVB :8 ;elpmas evitageN :7 ;lm/ DICT 01 :6 ;lm/ DICT 01 :5 ;lm/ DICT 01 :4 ;lm/ DICT 01 :3 ;lm/ DICT 01 :2 ;lm / DICT 01 :1 ;reddal...
- 6
- 347
- 0
Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx
... incremental dilutions of competitor DNA on the y-axis Solving for the antilog of x when y = will give the concentration of unknown amount of DNA – that of CD4, CD8 or GAPDH The success of the RNA extraction ... imaging is employed [9] The standard curve plots the log cDNA/competitor band intensity (as determined by analysis of PICT files with NIH image) on the x-axis versus the log of incremental dilutions ... Madison, WI), diluted to 3, then µl is used as template in a 25 µl PCR The remainder of the reactions were made up by µl PCR Buffer (Gibco BRL, Grand Island, NY), 0.25 µg of each primer, mM MgC12...
- 4
- 319
- 0
Xây dựng qui trình phát hiện đồng thời yeallow head virus(YHV), taura syndrome virus(TSV) và gill associated virus(GAV) trên tôm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction
... 1. 1 .1 Tình hình nuôi tôm dịch bệnh giới 11 1. 1.2 Tình hình nuôi tôm dịch bệnh Việt Nam 12 1. 2 Tác nhân gây bệnh 13 1. 2 .1 Yellow head virus (YHV) 13 1. 2 .1. 1 ... 13 1. 2 .1. 1 Hình thái cấu trúc 13 1. 2 .1. 2 Cách thức lan truyền 13 1. 2 .1. 3 Dấu hiệu bệnh lý 14 1. 2.2 Taura syndrome virus (TSV) 15 1. 2.2 .1 Hình thái ... 15 1. 2.2.2 Cách thức lan truyền 16 1. 2.2.3 Dấu hiệu bệnh lý 16 1. 2.3 .1 Hình thái cấu trúc 17 1. 2.3.2 Cách thức lan truyền 17 1. 2.3.3 Dấu...
- 59
- 363
- 0
Báo cáo y học: " A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus" pptx
... diagnosis of canine distemper virus Chinese journal of virology J Virol 19 99, 5 :18 0 -18 4 11 Yeon-sil Shin: Detect the PBMC of CDV N gene with RT-PCR Abroad Veterinary 19 97, 17 :26-29 12 Yong-Hwan ... its specificity Extracted RNA from serially diluted (10 4, 10 3, 10 2, 10 1, 10 0, 10 -1, 10 -2, 10 -3 TCID50) CDV cell cultures (10 6.5 TCID50/mL) were assayed by RT-nPCR to determine its sensitivity RTnPCR ... replicates of the multiplex RT-nPCR gave consistent results, indicating the repeatability of the assay Figure Amplification of genomes of different easily infected canine viruses by multiplex...
- 6
- 480
- 0
Báo cáo hóa học: "Detection of carcinoembryonic antigen messenger RNA in blood using quantitative real-time reverse transcriptase-polymerase chain reaction to predict recurrence of gastric adenocarcinoma" potx
... distribution of (CEA mRNA/GAPDH mRNA) × 10 6 in this group of patients 0.063 Sex Female 41 12 29 Male 82 33 49 T1 10 T2 16 13 T3 T4 73 24 26 10 47 14 N0 31 11 20 N1 43 15 28 N2 29 21 N3 20 11 ... ≤40 13 10 41- 50 20 11 51- 60 39 30 61- 70 >70 42 18 24 mean corrected CEA mRNA score [(CEA mRNA/ GAPDH mRNA) × 10 6] of the 12 3 patients was 37, 510 .0 (range, 0-3,695,652 .1) copies Figure showed the ... 0.986 -1. 050 0.273 Histological grade Poorly Well/moderately 0. 412 0 .17 1-0.990 0.047 pT 2/3/4 Tis /1 1.673 0 .10 0-8.690 0.947 pN (+) (-) 2.030 0.264 -15 . 611 0.497 Stage 3/4 ½ 1. 437 0 .12 4 -16 . 613 0.7 71 CEA mRNA...
- 8
- 439
- 0
Báo cáo y học: "Expression analysis of three isoforms of hyaluronan synthase and hyaluronidase in the synovium of knees in osteoarthritis and rheumatoid arthritis by quantitative real-time reverse transcriptase polymerase chain reaction" potx
... CGCAGCTGGTGTCATCCTCT 10 69 – 10 88 11 59R CAGCAGCCGTGTCAGGTAATC 11 59 – 11 39 probe TACACCACAAGCACGGAGACCTGCC 11 03 – 11 27 11 30F GCCTCACACACCGGAGATCT 11 30 – 11 49 12 02R GCTGCACTCACACCAATGGA 12 02 – 11 83 probe HYAL-3 14 9 ... AATACACTGCACACAGCCAAAGTAG 10 05 – 9 81 TCATGGATTTCCTTCCTGAGCAGCGT 913 – 938 15 61F AGTGGTGCTCTGGGTGAGCT 15 61 – 15 80 16 67R TGGTCACGTTCAGGATGAAGG 16 67 – 16 47 probe CCAAGGAATCATGTCAGGCCATCAAGG 15 96 – 16 22 10 69F CGCAGCTGGTGTCATCCTCT ... weight ( 10 4 Da) Controls 3 .1 ± 0.4 365 ± 52 OA 1. 2 ± 0.2* 212 ± 37* RA 0.8 ± 0.3* 16 3 ± 33* * P < 0. 01 in comparison with controls synthesis in vitro [ 41] HAS activity of stable transfectants of HAS-2...
- 7
- 466
- 0
Báo cáo y học: " A duplex real-time reverse transcriptase polymerase chain reaction assay for detecting western equine and eastern equine encephalitis viruses?" docx
... + 15 .25 10 -2 4/4 + 18 .29 10 -3 10 -4 4/4 4/4 + + 22.02 25.49 10 -5 4/4 + 29.28 10 -6 2/4 + 32.79 10 -7 0/4 + 36.03 10 -8 0/4 - TCID50: 10 6/0 .1 ml 10 -1 10-2 4/4 4/4 + + 11 .37 16 .25 10 -3 4/4 + 18 .54 10 -4 ... 22.03 10 -5 4/4 + 27.35 10 -6 2/4 + 30 .18 10 -7 1/ 4 + 34.79 10 -8 EEEV 0/4 + 37.59 6.25 TCID50: 10 /0 .1 ml Sensitivity of the duplex system compared to virus isolation For a comparative study of the ... Detection of the mimic samples by the duplex real-time RT-PCR The mimic samples were prepared by mixing the virus with the mouse brain tissue, then the brain tissues were grinded, and the RNA was...
- 5
- 278
- 0
Báo cáo y học: " A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control" docx
... Reproducibility Target HCV RNA (IU/ml) Number of determinations Mean Ct SD CV (%) Intra-assay 10 5 10 27 .15 0.25 0.93 10 4 10 31. 09 0.33 1. 07 10 2 10 38. 31 0. 51 1.34 10 5 10 27.05 0.29 1. 08 10 4 10 31. 05 ... 10 0 10 3 24/24 10 0 10 2 24/24 10 0 50 24/24 10 0 25 16 /24 66.6 10 9/24 37.5 Meng and Li Virology Journal 2 010 , 7 :11 7 http://www.virologyj.com/content/7 /1/ 117 Page of Table 3: Reproducibility of the ... March 2 010 Accepted: June 2 010 Published: June 2 010 © 2 010 Mengavailable from: distributed under the terms of the Creative This is an Open Access7 :11 7 http://www.virologyj.com/content/7 /1/ 117 Commons...
- 9
- 322
- 0
Báo cáo y học: "Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR) for diagnosis of natural infection with canine distemper virus" potx
... 2.4 2 .1 2.3 3.2 TW-6 2.0 2.3 1. 9 0 .1 3.3 TW-7 1. 9 2.2 1. 8 0.0 3.2 0 .1 Vacc N 19 .3 20.2 19 .9 19 .6 20.4 19 .7 19 .6 Vacc P 6.7 6.5 6.8 6.8 7.2 7.0 6.8 15 .6 Vacc Q 16 .9 17 .1 17.3 17 .2 17 .0 17 .3 17 .2 ... established on the basis of the genetic divergence spanning from the intergenic region of the M and F genes to the Fsp region of F gene The level of genetic variation of the F gene between the ... 2 010 Accepted: 10 June 2 010 Published: 10 June 2 010 © 2 010 Chulakasian et from: distributed under the terms of the Creative This is an Open Access7 :12 2 http://www.virologyj.com/content/7 /1/ 122...
- 9
- 345
- 0
Báo cáo khoa học: " An analysis of the subtypes of dengue fever infections in Barbados 2003–2007 by reverse transcriptase polymerase chain reaction" pptx
... Haematuria Hepatitis Sore throat Bleeding gums Blood-shot eyes Petechiae Shock 85 45 65 39 19 18 16 15 15 13 12 11 11 5 4 1 69 63 52 32 15 15 13 12 12 11 10 9 4 3 0.8 0.8 0.8 Page of (page number ... 0 16 17 –20 21 30 31 40 41 50 50+ Age Unknown Total 2003 Male Female Male Female Male Female Male Female Male Female Male Female 1 16 14 21 26 47 0 2 14 2 3 13 23 36 3 2 15 13 28 2 1 1 14 1 1 10 ... Virology Journal 2008, 5 :15 2 Lanes Lanes A 10 11 A 12 13 14 15 16 17 18 19 20 21 22 Figure patients infected during the period of 2003–2007 in Barbados RT-PCR2detection and typing of dengue virus in...
- 6
- 354
- 0
Báo cáo thú y: " DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls" pot
... Scandinavica 2 010 , 52 :18 http://www.actavetscand.com/content/52 /1/ 18 Page of Figure Example of the AMP PCR profile generated by the AMP PCR technique This profile belonged to primer No .15 S = Sperm, ... in the digested DNA template (Fig 1c) The formation of this marker is still under investigation The observation of marker pattern was done by placing the dried silver-stained gel attached on the ... 61 48 55.0 ± 5.6 % Total marker 5.2 5.5 4.5 5 .1 ± 0.5 10 77 11 02 10 72 10 83.7 ± 16 .1 Phutikanit et al Acta Veterinaria Scandinavica 2 010 , 52 :18 http://www.actavetscand.com/content/52 /1/ 18 Page of...
- 9
- 258
- 0
Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm A H5N1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reacti
... 1. 1.3 Hệ gen protein virus A/H5N1 1. 1.4 Chu trình tái virus cúm A/H5N1 1. 1.5 Hiện tượng biến đổi kháng nguyên virus cúm A .11 1. 1.6 Khả thích ứng vật chủ virus cúm A 12 1. 1.7 ... cúm A/H5N1 14 1. 1.8 Sức đề kháng virus cúm A 15 1. 2 CHẨN ĐOÁN, ĐIỀU TRỊ VÀ DỰ PHÒNG BỆNH CÚM GIA CẦM A/H5N1 .16 1. 2 .1 Triệu chứng nhiễm cúm A/H5N1 16 1. 2.2 Các ... 2 011 MỤC LỤC MỞ ĐẦU Chƣơng TỔNG QUAN 1. 1 ĐẠI CƢƠNG VỀ VIRUS CÚM A/H5N1 .3 1. 1 .1 Phân loại học danh pháp 1. 1.2 Hình thái cấu trúc virus cúm A/H5N1 1. 1.3...
- 79
- 664
- 0
Recombinant DNA I - Basics of molecular cloning Polymerase chain reaction cDNA clones and screening
... Utilizes microbiological selection and screening procedures to isolate a gene that represents as little as part in a million of the genetic material in an organism • DNA from the organism of ... primers, and synthesize new DNA: 14 duplex molecules of desired product PCR: make large amounts of a particular sequence • The number of molecules of the DNA fragment between the primers increases ... For n = number of cycles, the amplification is approximately [2exp(n -1) ]-2 • After 21 cycles, the fragment has been amplified about a million-fold • E.g a sample with 0 .1 pg of the target fragment...
- 23
- 460
- 0
ỨNG DỤNG PHƯƠNG PHÁP PCR (POLYMERASE CHAIN REACTION) VÀ PHƯƠNG PHÁP NUÔI CẤY ĐỂ KHẢO SÁT SỰ NHIỄM VI SINH VẬT GÂY BỆNH TRONG THỰC PHẨM ĐƯỜNG PHỐ
... giải khát 14 Bảng 1. 6 Tiêu chuẩn Bộ Y tế nhóm thực phẩm chế biến từ sữa 14 Bảng 1. 7 Tiêu chuẩn Bộ Y tế nhóm sữa chua 15 Bảng 1. 8 Tiêu Bộ Y tế nhóm kem, nước đá 15 Bảng 1. 9 Bảng ... ngộ độc thực phẩm TP HCM 20 01 2002 2003 2004 2005 2006 29 22 26 27 39 Số người ngộ độc 796 930 11 58 964 15 36 15 64 Ngộ độc vi sinh (%) 83,9 75,7 67,7 64 ,1 39 ,1 38 ,1 0 Số vụ ngộ độc thực phẩm Số ... (tương đương 1g mẫu) pha lỗng 10 lần cách trộn với 90ml mơi trường TSB Nếu mẫu chứa 10 CFU/g 10 0ml dịch pha lỗng chứa 10 CFU hay 1CFU /10 ml Hút 9,9ml dịch pha lỗng để tăng sinh 37oC 18 - 22 trước...
- 84
- 1,794
- 7
KỸ THUẬT PCR (POLYMERASE CHAIN REACTION)
... ứng với x 10 -6/(6,4 x 10 9 x 650) = 2,4 .10 -19 mol Vì ADN người chứa khoảng 6,4 x 10 bp khối lượng phân tử trung bình cặp bazơ 650 Da nên µ g ADN người tương với 2,4 x 10 -19 mol x x 10 23 (số Avogadro) ... in vitro Taq ADN polymerase ghép sai bazơ với tần số 1/ 10 - 1/ 105 Tỷ lệ sai sót xấu 1/ 104, nghĩa 1kb trình tự nhân sau 25 vòng tái khoảng 10 % sản phẩm có chứa đột biến Tuy nhiên, đột biến xảy ... Lịch sử Phương pháp chạy PCR Kary Mullis phát minh, ông đoạt giải Nobel Hóa học vào tháng 10 năm 19 93 cho thành tựu này, sau năm ông đưa ý tưởng Ý kiến Mullis phát triển quy trình mà ADN nhân lên...
- 25
- 1,067
- 5
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25