p2x1 and p2x2 receptors

Báo cáo hóa học: " Investigating the Influence of PFC Transection and Nicotine on Dynamics of AMPA and NMDA Receptors of VTA Dopaminergic Neurons" doc

Ngày tải lên : 19/06/2014, 08:20

... injection even within one hour, and AMPA/NMDA area ratio and the KL divergence analysis method are able to provide a more complete understanding of AMPA and NMDA responses, and may be better fit for ... calculated the KL divergence for each pair of AMPA and NMDA signals, under different experimental conditions (nicotine and saline and also with PFC intact and transected rats) Subsequently, the statistical ... AMPA and NMDA curves represent the whole GluR response with respect to time Therefore, we estimated the AMPA/NMDA area ratio and KL divergence to better understand the dynamics of AMPA and NMDA...

28
431
0

Báo cáo hóa học: " Expression of HIV receptors, alternate receptors and co-receptors on tonsillar epithelium: implications for HIV binding and primary oral infection" doc

Ngày tải lên : 20/06/2014, 01:20

... Expression of HIV co -receptors CXCR4 and CCR5 Several previous studies have reported expression of the principal HIV co -receptors, CXCR4 and CCR5, on cultured epithelial cells [32,48,49] and that oral ... damage and repair in ex vivo tonsil organ culture and HIV infection of tonsil cells Epithelial damage and repair in ex vivo tonsil organ culture and HIV infection of tonsil cells Small randomly ... HIV virions and exposed mucosal surfaces and that both the properties of the inoculum (cell free HIV virions and/ or cell associated infectivity in the form of HIV-infected cells) and the characteristics...

13
308
0

Báo cáo khoa hoc:" Expression of estrogen and progesterone receptors in vestibular schwannomas and their clinical significance" docx

Ngày tải lên : 11/08/2014, 07:21

... obtained and the standard streptavidin biotin peroxidase immunohistochemical method was used for the expression of estrogen and progesterone receptors Estrogen receptor (Clone 1D5, Dako, USA) and ... cerebellopontine angle tumor and it expresses various hormone receptors for examples estrogen, progesterone, androgen, somatostatin and glucocorticoid The clinical significance of these receptors is that ... from ligand binding studies and immunohistochemical methods to molecular techniques like polymerase chain reaction and Northern blot analysis Positivity of estrogen and progesterone receptors...

5
252
0

Báo cáo khoa học:" Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection" pptx

Ngày tải lên : 12/08/2014, 04:21

... (C17) and CCRT (C4, C5, and C6) expressing hCD4 and hCCR5 molecules were established using a pleiotropic retrovirus expression system and analyzed by flow cytometry Measurable levels of both receptors ... parental cell line and the derived clone K4 which expresses hCD4 and hCXCR4 infected with MN isolate; (B), CCRT parental cell line and the C4, C5, and C6 derived clones expressing hCD4 and hCCR5 infected ... expressing human co -receptors for HIV-1 Isolation and cloning of cotton rat cells expressing human co -receptors for HIV-1 (A), VCRT C17; (B), CCRT C4; (C), CCRT C5; (D), CCRT C6; and (E), CCRT K4,...

9
329
0

Báo cáo khoa học: " Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection" pdf

Ngày tải lên : 12/08/2014, 04:21

... (C17) and CCRT (C4, C5, and C6) expressing hCD4 and hCCR5 molecules were established using a pleiotropic retrovirus expression system and analyzed by flow cytometry Measurable levels of both receptors ... parental cell line and the derived clone K4 which expresses hCD4 and hCXCR4 infected with MN isolate; (B), CCRT parental cell line and the C4, C5, and C6 derived clones expressing hCD4 and hCCR5 infected ... expressing human co -receptors for HIV-1 Isolation and cloning of cotton rat cells expressing human co -receptors for HIV-1 (A), VCRT C17; (B), CCRT C4; (C), CCRT C5; (D), CCRT C6; and (E), CCRT K4,...

9
251
0

Báo cáo khoa học: "The early responses of VEGF and its receptors during acute lung injury: implication of VEGF in alveolar epithelial cell survival" ppt

Ngày tải lên : 13/08/2014, 03:20

... scoring and supervised pathological studies TKW and SK provided assistance in physiological studies and data interpretation ML conceived the study, and participated in its design and coordination and ... immunostaining and confocal microscopy may provide more convincing evidence When using western blotting and real-time quantitative RTPCR to measure the protein and mRNA levels of VEGF and its receptors, ... surrounding cells and tissues may mask the changes of VEGF, or its receptors Conclusion Our results suggest that significant and dynamic changes of expression of VEGF and its receptors take place...

13
290
0

Serotonin and serotonin receptors in neural stem and progenitor cell proliferation

Ngày tải lên : 11/09/2015, 10:15

... 5-HT1A receptors 1.2.3.1.2 5-HT1B receptors 1.2.3.1.3 5-HT1D receptors 1.2.3.1.4 5-HT1E and 5-HT1F receptors 1.2.3.2 5-HT2 receptor family 1.2.3.2.1 5-HT2A receptors 1.2.3.2.2 5-HT2B receptors ... relatively low and therefore 5-HT1B receptors can be discriminated from the other 5-HT receptors As there are structural similarities between 5-HT1B and 5-HT1D receptors, only high affinity and selective ... Siam, Ms Raquel Magalhães and Mr Lee Kong Heng for their help and insights for the collaborative work on cryopreservation; and also to Assoc Prof Manoor Prakash Hande and Dr Anuradha Poonepalli...

226
228
0

Tài liệu Báo cáo khoa học: Afﬁnity and kinetics of proprotein convertase subtilisin ⁄ kexin type 9 binding to low-density lipoprotein receptors on HepG2 cells docx

Ngày tải lên : 14/02/2014, 14:20

... Dissociation time courses and effects of unlabeled ligands and low pH on the dissociation rates of [125I]TC-PCSK9 (A) and [125I]TC-PCSK9-D374Y (B) from HepG2 cells Binding to equilibrium and removal of ... to dimeric receptors that release bound ligand slowly because they convert rapidly The slow phase of association could represent binding to monomeric receptors that release bound ligand rapidly ... internalize and degrade [125I]TC-PCSK9 at 37 °C However, the interaction of ligands with cell surface receptors at 37 °C is a function not only of the rate constants of association and dissociation,...

13
712
0

Tài liệu Báo cáo khoa học: Nuclear receptors in the mosquito Aedes aegypti Annotation, hormonal regulation and expression proﬁling ppt

Ngày tải lên : 18/02/2014, 13:20

... included a DNase I treatment, and cDNA synthesized as described above The time points analyzed were 1–2 and 4–5 days pre-vitellogenesis, and 6, 12, 24, 36, 48 and 72 h PBM To standardize qPCR inputs, ... was extracted from the fat body and ovaries of pre-vitellogenic females 5–6 days after eclosion and from vitellogenic females 6–12 and 18–24 h after a blood meal, and then was subjected to 1236 ... An gambiae and Ap mellifera NRs, and one which is a likely ortholog of the Ap mellifera and T castaneum PNR-like NR [20–22] that is also present in the genome of An gambiae (Table S1 and Fig 1)...

22
578
0

Tài liệu Báo cáo khoa học: Neuropeptide Y-family receptors Y6and Y7in chicken Cloning, pharmacological characterization, tissue distribution and conserved synteny with human chromosome region docx

Ngày tải lên : 19/02/2014, 07:20

... ligand afﬁnity between Y7 and Y2 may prove very useful for studies of ligand–receptor interactions and 3D modeling, and we have previously been able to utilize differences between chicken and ... distribution and phylogeny of the chicken Y6 and Y7 receptors and performed the initial pharmacological characterization of the latter It is clear, from these studies, that the Y6 and Y7 receptors ... radioligand This radioligand had iodinated tyrosines at positions 21 and 27 and a speciﬁc activity of 4000 CiÆmmol)1 Saturation experiments were carried out with serial dilutions of radioligand, and...

16
580
0

Tài liệu Báo cáo khoa học: Constitutive oligomerization of human D2 dopamine receptors expressed in Spodoptera frugiperda 9 (Sf9 ) and in HEK293 cells Analysis using co-immunoprecipitation and time-resolved ﬂuorescence resonance energy transfer pdf

Ngày tải lên : 21/02/2014, 00:20

... expression of HIV- and FLAG-tagged D2L and D2S receptors in Sf9 cells To achieve this, mAbs directed against gp120 (clone 11/4C) and the FLAG sequence were used, and Fig shows the band pattern visualized ... Anti-gp120 Ig and anti-FLAG Ig identiﬁed bands corresponding to proteins with a molecular mass equivalent to 43 kDa and 85 kDa for D2L and 39 kDa and 80 kDa for D2S (Fig 1) No bands were detected ... the dopamine D2L and D2S receptors can form constitutive homo- and hetero-oligomers in two expression systems (Sf9 and HEK293 cells) and these are not regulated by receptor ligands Our study applied,...

11
618
0

Tài liệu Báo cáo khoa học: A synthetic weak neurotoxin binds with low afﬁnity to Torpedo and chicken a7 nicotinic acetylcholine receptors docx

Ngày tải lên : 21/02/2014, 03:20

... the resolution of the X-ray and NMR structures of the Wntx called bucandin and WTX [16,27,28] When we started this work, 22 amino acid sequences of Wntxs were known and it was clear to us that ... Considering that the two toxins display 11 residue differences and that the competition systems used (human and rat on one hand, and chicken on the other) are not identical in the two studies, ... precipitates were washed three times and dried, dissolved in 10% acetic acid and lyophilized The synthetic toxin was reduced with molar excess of TCEP under acidic conditions and puriﬁed by RP-HPLC using...

10
395
0

Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Ngày tải lên : 07/03/2014, 16:20

... SMEZ1 and 2), three have one Cys (SEI, SEK and SPEC), two have three Cys (SEG and SPEA) and only SSA has more than that, five Cys As discussed later, the fact that SSA has two Cys residues (Cys26 and ... hVb2.1hCb2 and hVb1hCb2 (genes kindly provided by U Utz and R P Sekaly, University of Montreal, Canada), were cloned between the NdeI and EcoRI restriction sites of the pET17b expression vector and ... NaCl/Pi and concentrated to mgÆmL)1 hVb2.1hCb2 and hVb1hCb2 were also produced as inclusion bodies and refolded at pH 8.5 Purification steps included gel filtration on a Superdex 200 FPLC column and...

9
485
0

Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

Ngày tải lên : 07/03/2014, 16:20

... activation and interaction with receptor kinases 130 A Faussner et al Results Construction of truncated and point mutated B2wts and B1 ⁄ B2 receptor chimeras Several studies with truncations of, and ... 2004 FEBS A Faussner et al Role of helix and C-termini in bradykinin receptors Fig Schematic representation of the C-terminal B1wt and B2wt sequences and chimera thereof The C-terminal sequences ... B1CB2) and at Y7.53 within the NPXXY sequence (chimera B1YB2) 131 Role of helix and C-termini in bradykinin receptors A Faussner et al Table Receptor density (Bmax), receptor afﬁnity (Kd), basal and...

12
595
0

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Ngày tải lên : 07/03/2014, 16:20

... TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of the new insert, as in the case of pJH2-I7 Plasmids pJH2-I7 and pJH2-OR17-40 ... Expression of olfactory receptors in yeast for screening to remove glucose and cultured for 4–6 h in the selection media containing 3% lactate, then pelleted and diluted to a D600 0.5 and ﬁnally cultured ... the endogenous yeast Ga protein subunit, Gpa1 Yeast Gpa1, Ste4 and Ste18 are structurally and functionally similar to mammalian Ga, b and c subunits, respectively [30] In many cases, this functional...

14
473
0

Báo cáo Y học: Functional reconstitution of the HIV receptors CCR5 and CD4 in liposomes pot

Ngày tải lên : 08/03/2014, 09:20

... concentrations of [125I]MIP-1a and cold MIP-1a or RANTES (1000 and 500-fold [125I]MIP-1a quantities) Unbound ligand was removed by filtration on BSA-presaturated GFB-filters (Whatman), and the filters were ... concentrations between 0.1 and 0.4 mM was added to liposomes (66 lM of lipid) containing N-NBD-PtdEth and N-Rh-PtdEth at time 0, and the fluorescence of N-NBD-PtdEth was measured and normalized to a ... ultracentrifugation The consecutive supernatants S1, S2 and S3 and the final proteoliposome pellet (PL) were analysed by Western blot and autoradiography, and show successful reconstitution of the protein,...

12
541
0

Báo cáo khoa học: Soluble recombinant CD69 receptors optimized to have an exceptional physical and chemical stability display prolonged circulation and remain intact in the blood of mice doc

Ngày tải lên : 16/03/2014, 04:20

... (lanes and 3), CD69NG70 (lanes and 5), CD69NV82 (lanes and 7) CD69NS84 (lanes and 9), rat CD69 (lanes 10 and 11) and mouse CD69 (lanes 12 and 13) was performed under nonreducing (even lanes) and ... either soluble CD69 ligands, or by soluble CD69 receptors might protect CD69+ killer cells from apoptosis, and render them more available for killing of the tumors Structural and biochemical studies ... unusual solubility and stability To assess the solubility and stability of the recombinant preparations of CD69, we concentrated both CD69NG70 and CD69NV82 using a Centricon 10 device, and were able...

18
400
0

Báo cáo khoa học: Involvement of NF-jB subunit p65 and retinoic acid receptors, RARa and RXRa, in transcriptional regulation of the human GnRH II gene pot

Ngày tải lên : 16/03/2014, 10:20

... Differential effects of ligand-activated RARa and RXRa on the promoter activity of the hGnRH II gene in TE671 and JEG-3 cells In vivo effect of RARa and RXRa with their ligands, ATRA and 9-cisRA, on the ... transfected with RARa and ⁄ or RXRa (without RA treatment), simultaneous ligand activation of RARa and RXRa (cotransfection of RARa and RXRa together with treatment of both ATRA and 9-cisRA) provided ... TE671 JEG-3 ‡ ‡ ‡ No treatment Ligand-bound (RARαRXRα) dimer Fig Effects of ligand-activated RARa and RXRa on hGnRH II gene expression The effect of ligand-bound RARa and RXRa on the endogenous hGnRH...

12
399
0

Báo cáo khoa học: Novel a-conotoxins from Conus spurius and the a-conotoxin EI share high-afﬁnity potentiation and low-afﬁnity inhibition of nicotinic acetylcholine receptors doc

Ngày tải lên : 16/03/2014, 11:20

... acetylcholine receptors (nAChRs) belong to the a and aA families On the basis of the number of residues between the second and third cysteines and on the spacing between the third and fourth cysteines ... peptides SrIA and SrIB unambiguously deﬁned 12 and 13 residues, respectively Low glutamine signals at positions 12 and 15 of SrIA and at position 15 of SrIB Fig Puriﬁcation of SrIA and SrIB (A) ... receptor, as shown in Fig 4A, and also for the a4b2 and a3b4 receptors [12–14] The pretreatment time and the concentration of each toxin were varied in the range 3–150 s and 0.2 nm to 10 lm, respectively...

14
532
0

A3 Adenosine Receptors from Cell Biology to Pharmacology and Therapeutics pdf

Ngày tải lên : 22/03/2014, 23:20

... Adenosine Receptors from Cell Biology to Pharmacology and Therapeutics Pier Andrea Borea Editor A3 Adenosine Receptors from Cell Biology to Pharmacology and Therapeutics Editor Pier Andrea Borea ... Tabrizi, and Delia Preti Molecular Modeling and Reengineering of A3 Adenosine Receptors 149 Stefano Moro, Erika Morizzo, and Kenneth A Jacobson Part V Effects on Tissues and Organs and ... adenosine receptors The first edition of “A3 Adenosine Receptors from Cell Biology to Pharmacology and Therapeutics” volume is dedicated to my wife Cristina and to all the friends and colleagues...

324
710
0