oxidative stress in diabetes mellitus s a moussa
báo cáo hóa học: " The microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer''''s disease" ppt
... Helkala EL, Laakso MP, Hanninen T, Hallikainen M,Alhainen K, Soininen H, Tuomilehto J, Nissinen A: Midlife vascularrisk factors and Alzheimer&apos ;s disease in later life: longitudinal,population ... purposes)Journal of NeuroinflammationOpen AccessReviewThe microglial NADPH oxidase complex as a source of oxidative stress in Alzheimer&apos ;s diseaseBrandy L Wilkinson* and Gary E LandrethAddress: Alzheimer ... peroxidation and oxidative imbalance:early functional events in Alzheimer&apos ;s disease. J Alzheimers Dis2004, 6:171-175.26. Markesbery WR: Oxidative stress hypothesis in Alzheimer&apos ;s disease....
- 12
- 413
- 0
Báo cáo khoa học: A nonribosomal peptide synthetase (Pes1) confers protection against oxidative stress in Aspergillus fumigatus ppt
... GGCTCTGGAACTGAATAAAGCGACpes1 A2 reverse GTCCCATATATCCGCTTGCAATCTpes1 A4 forward TCTGACTCCGTCGATAGCTAGCATpes1 A4 reverse CCAGATCCTCACGACTGATAAGCTCpes1C2forward GAGATCTAGATACCCATGCAGCCCTGTCpes1C2reverse ... GATATCGAATTCGCCTCAAACAATGNested forward GAGACCTAGGAAGCAATGTCTCCGCAACATTTGGCGACATGGTCTCATATNested reverse GAGACCGCGGAAGCTTCTGGACCTTTTCGCGTGTTGCTTCCGACATAGGANRP synthetase in Aspergillus fumigatus ... pes1 in pro-tecting A. fumigatus against oxidative stress. Semiquantitative analysis of pes1 expression hasconfirmed that the gene is present, and differentiallyexpressed, in four strains of A. ...
- 16
- 361
- 0
báo cáo hóa học: " Brain inflammation and oxidative stress in a transgenic mouse model of Alzheimer-like brain amyloidosis" pptx
... G, Aliev G, Irai K, Takeda A, Balraj EK, Jones PK,Ghanbari H, Wataya T, Shimohana S, Chiba S, Atwood CS, PetersenRB, Smith MA: Oxidative stress is the earliest event in Alzhe-imer&apos ;s disease. ... After 15 min, the reaction was stopped andabsorbance immediately read at 450 nm. Oxidized pro-tein standards, internal controls and blanks were alwaysassayed at the same time and in the same ... therelationship between brain inflammation responses and oxidative stress has not yet been clearly delineated in AD.For example, its is possible to consider these two events aselements of the same...
- 9
- 490
- 0
Báo cáo y học: "NITRIC OXIDE (NO), CITRULLINE – NO CYCLE ENZYMES, GLUTAMINE SYNTHETASE AND OXIDATIVE STRESS IN ANOXIA (HYPOBARIC HYPOXIA) AND REPERFUSION IN RAT BRAIN"
... inflammation after anoxia. The Figure 2 shows activities of AS, AL and arginase in the study. AS and AL activities increased in all the three brain regions significantly in anoxia suggesting ... stress in anoxia and reperfusion and suggests a possible role for anti oxidants in preventing neuro-degeneration in anoxia and reperfusion injuries to brain. The increased arginase and sustained ... (20). Apart from NO synthesis L-arginine may also serve as a substrate for glutamate formation and may also provide increased substrate for arginase (50). No significant changes in the activity...
- 8
- 622
- 0
Tài liệu Báo cáo khoa học: Oxidative stress in the hippocampus after pilocarpineinduced status epilepticus in Wistar rats doc
... dismutase and catalase activities in the hippocampus of adult rats afterpilocarpine-induced SETable 1 shows superoxide dismutase and catalase activ-ities in the hippocampus after seizures and SE ... Oxidative stress in the hippocampus after pilocarpine-induced status epilepticus in Wistar ratsRivelilson M. Freitas, Silvaˆnia M. M. Vasconcelos, Francisca C. F. Souza, Glauce S. B. Vianaand ... data suggest that the hippocampus doesnot use superoxide dismutase as the major free-radical-scavenging system [9,30]. It probably uses other scav-enging systems (catalase and GSH).Pilocarpine-induced...
- 6
- 480
- 0
Báo cáo khoa học: Calcium, mitochondria and oxidative stress in neuronal pathology Novel aspects of an enduring theme pdf
... receptor-based mechanisms are modulatedby [Ca2+]e: (a) the Ca2+-sensing receptor is activated bymillimolar changes in [Ca2+]e, and is widely distributed in mammalian tissues including brain ... mechanisms may act alone or in concert with nonselective Ca2+channels in producingsignificant excitotoxic Ca2+increases following ischemicinsults.TRP channels as candidates for paradoxicalCa2+-increasesTRP ... latter study the authors also demonstratedthat the increase in superoxide radical formation ispredominantly associated with extramitochondrialphospholipase A( 2) (PLA2) activation, and it does...
- 18
- 549
- 0
Báo cáo khoa học: Pyruvate:ferredoxin oxidoreductase and bifunctional aldehyde–alcohol dehydrogenase are essential for energy metabolism under oxidative stress in Entamoeba histolytica pdf
... and outlined their relevance as significant con-trolling steps of energy metabolism in parasites subjected to oxidative stress. AbbreviationsAcCoAS, acetyl-coenzyme A synthetase; Cat, catalase; ... fluxes in live parasites.ResultsKinetic characterization of EhPFOR in amebalextractsPFORs in several anaerobic parasites have been foundattached to plasma and hydrogenosomal membranes[20,21], ... acetyl-CoA. Basal activity withNADH and the extract was always subtracted. Completeinhibition of the ADH activity with pyrazole was deter-mined separately in the ADH assay. Acetyl-CoA synthetaseactivity...
- 14
- 420
- 0
Báo cáo khoa học: Fasting-induced oxidative stress in very long chain acyl-CoA dehydrogenase-deficient mice pdf
... genesregulating peroxisomal and microsomal oxidation pathways was analyzedby RT-PCR. In addition, glutathione peroxidase and catalase activities, aswell as thiobarbituric acid reactive substances, ... mirrorsthe effects observed for GPX and catalase activities,thus indicating that a diet based on MCTs raises therisk of ROS production. The TBARS concentrationwas strongly increased after fasting ... skeletalmyopathy also occur in long-chain fatty acid oxidationdefects [4]. During these catabolic situations, long-chain fatty acids cannot be oxidized, and accumulate in tissues as long-chain acyl-CoAs and...
- 10
- 381
- 0
Báo cáo hóa học: " Oxidative stress in NSC-741909-induced apoptosis of cancer cells" potx
... Furusawa S, Kimura E, Kisara S, Nakano S, Murata R, Tanaka Y, Sakaguchi S, Takayanagi M, Takayanagi Y, Sasaki K: Mechanism of resistance to oxidative stress in doxorubicin resistant cells. Biol ... kinase phosphatases [3]. MAP kinase phosphatases(MKPs) are a group of dual-specificity phosphatases thatinactivate MAPKs by dephosphorylating their threonineand tyrosine residues. At least ... pro-inflammatorycytokine signaling cascade, and the delayed and sustainedactivation is mediated by ROS [45], which inactivateMAP kinase phosphatases by reacting with catalyticcysteine and causing...
- 10
- 576
- 0
Báo cáo khoa học: "Comparative study of PM2.5 - and PM10 - induced oxidative stress in rat lung epithelial cells" pptx
... Western blotting detection system (Amersham).Statistical analysisData were expressed as mean±SD. For comparison ofmeans, Student s t-test was performed using SPSS 9.0(SPSS Inc., USA) statistical ... 5'-TTACTTTCTTGTTCAGCGACCGA-3' and antisense 5'-C ACCTTCGTATAGAATGTCCGCA-3', Cu/Zn-SOD (541 bp): sense 5'-AGGATTAACTGAAGGCGAGCATG-3' and antisense 5'-GCCCAAGTCATCTTGTTTCTCGT-3', MTH1 ... (www.ncbi.nlm.nih.org) sequences. Mn-SOD(782 bp): sense 5'-GATGTGTGGAGCACGCTTACT-3' andantisense 5'-CACAATGTCACTCCTCTCCGAATTA-3',Catalase (763 bp): sense 5'-TTACTTTCTTGTTCAGCGACCGA-3'...
- 8
- 442
- 1
Báo cáo lâm nghiệp: "Response to an ozone gradient of growth and enzymes implicated in tolerance to oxidative stress in Acer saccharum (Marsh.) seedlings" pot
... increasing O3(Figs. 1 396 C. Gaucher et al.season suggested that less precursors and less energy was allo-cated to repair of injured foliar tissues. As PEPC transformedPEP to OAA and as ... symptomatic if at least2% of his area was injured.2.3. Enzymatic analysis2.3.1. In vivo nitrate reductase assayAt the field site, in parallel with the harvests and at all sam-pling dates, NR (E.C. ... photorespiratory pathway) in Pinus taeda needles exposed to air pollution.As a shade tolerant, slow growing species [3], sugar maplehas a low assimilation rate, leading to a compromise be-tween maximizing...
- 11
- 392
- 0
Báo cáo y học: "Nifedipine decreases sVCAM-1 concentrations and oxidative stress in systemic sclerosis but does not affect the concentrations of vascular endothelial growth factor or its soluble receptor" potx
... pathway is intrinsically defective in SSc.Keywords: nifedipine, oxidative stress, sVCAM-1, systemic sclerosis, VEGFIntroductionSystemic sclerosis (SSc) is a connective tissue diseasecharacterised ... endothelium-related indices, including increased plasma levels of mark-ers such as soluble vascular cell adhesion molecule 1(sVCAM-1). Thus, sVCAM-1 could be a useful parameterfor vascular assessment [6] and ... expression of adhe-Table 2Serum concentrations of vascular markers in patients with systemic sclerosis (SSc) at baseline and in controlsSerum constituent Controls (n = 20) SSc patients at baseline...
- 6
- 518
- 0
Báo cáo y học: "Potential involvement of oxidative stress in cartilage senescence and development of osteoarthritis: oxidative stress induces chondrocyte telomere instability and downregulation of chondrocyte function" pptx
... hypothesis that oxida-tive agents play a role in situ in chondrocytes and in cartilage changes in OA. These results also support theconcept that antioxidative agents may prevent oxidative stress- induced ... group, which was macroscop-ically normal). In these donor matched pairs of articular cartilage samples,antioxidative potential of the tissue was measured using anassay that is based on reduction ... closely related to the increase in senes-cence-associated β-galactosidase expression in humanchondrocytes, suggesting that chondrocyte senescence,at least in part, participates in the age-related...
- 12
- 407
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25