output a panel approach for the euro area
Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc
... N G PA P E R S E R I E S N O 115 / J A N U A RY 2010 DO BANK LOANS AND CREDIT STANDARDS HAVE AN EFFECT ON OUTPUT? A PANEL APPROACH FOR THE EURO AREA by Lorenzo Cappiello 2, Arjan Kadareja 3, ... 8765 Bank of Albania, Sheshi “Skënderbej”, No.1 Tirana, Albania; e-mail: kadareja@yahoo.com © European Central Bank, 2010 Address Kaiserstrasse 29 60311 Frankfurt am Main, Germany Postal address ... more widespread than in the euro area One example is the fact that securitisation is considerably more advanced in the US compared to the euro area For instance, by end-2007 the annualised sum...
- 30
- 911
- 0
WORKING PAPER SERIES NO 804 / AUGUST 2007 GROWTH ACCOUNTING FOR THE EURO AREA A STRUCTURAL APPROACH pptx
... possible euro area wide data are drawn from official sources such as Eurostat or the European Commission Historical data for euro area- wide aggregates were largely taken from the Area- Wide Model (AWM) ... of the nominal variables, although they have a procyclical appearance Overall, the application makes clear that the proposed extended framework allows for a formal analysis of various key aspects ... variables, although they have a procyclical appearance Overall, the application makes clear that the proposed extended framework allows for a formal analysis of various key aspects of potential...
- 48
- 606
- 0
The Relationship Between Bank and Interbank Interest Rates during the Financial Crisis: Empirical Results for the Euro Area pptx
... rate on the main refinancing operations Interest rate data types are either the Annualized agreed rate (AAR) or the Narrowly defined effective rate (NDER) The annualized agreed rate (AAR) is an interest ... January 2003 to September 2011 and the geographic area taken into account is the Euro area (changing composition) The banks’ counterpart sectors and the types of bank loans are: • Households and ... Data Source: European Central Bank The aim of this paper is to study how the financial crisis has affected the interest rate transmission mechanism for the Eurozone between market rates and bank...
- 36
- 671
- 0
The imPact of high and groWing government debt on economic groWth an emPirical inveStigation for the euro area docx
... burdens Unfortunately, data on the total private debt stock or at least private external debt17 are not readily available in a consistent manner for the euro area countries for a longer time span Instead, ... models for these factors For the ageing-related burden, we account indirectly by using the variable old dependency ratio as an explanatory factor for the private saving rate; the variable is ... variables are used in the empirical estimation in aggregated terms, total national saving/investment rate, as well as on a disaggregated basis, as public and private saving/ investment rate) other...
- 42
- 715
- 0
Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf
... similarly Average precision is the average of literal and nonliteral precision; similarly for average recall For overall performance, we take the f-score of average precision and average recall We calculated ... plus the manually evaluated literal and nonliteral 333 counts, for each target word It also provides the feedback set sizes for each target word The totals across all words are given at the bottom ... nonliteral language processing, but also as training data for other statistical NLP tasks References Srinivas Bangalore and Aravind K Joshi 1999 Supertagging: an approach to almost parsing Comput...
- 8
- 447
- 0
ECONOMIC OUTLOOK FOR THE EURO AREA IN 2011 docx
... public finances on capital markets in April and May forced a financial support package for Greece and the creation of the Financial Stabilization Mechanism (both backed by euro area states and the ... euro area is a significant downward risk for this forecast, as it was for the EFN summer forecast That said, it is reassuring that financing costs receded for Spain, by far the largest among the ... by the Bank of England, the Fed, and the Bank of Japan as well But the scope for expansive policy has become limited in most advanced economies As the upswing in Asia and Latin America is already...
- 11
- 312
- 0
ECONOMIC OUTLOOK FOR THE EURO AREA IN 2010 doc
... euro area, short-term forecasts of the main macroeconomic and financial variables, policy advice, and in-depth study of topics of particular relevance for the working of the European Economic and ... the same period a year earlier, except for the output gap that is the deviation of actual GDP from potential GDP as a per cent of potential GDP and except for the unemployment rate Point forecasts ... stock markets, indices of S&P 500 for the US and Euro Stoxx 50 for the euro area are about 45% higher than they were at their trough in March Prices for corporate bonds in advanced economies have...
- 11
- 334
- 0
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx
... Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients with limb ischaemia by autologous transplantation ... working days For the invasion assay, data were expresses as the percent invasion through the Matrigel matrix and membrane relative to the migration through the 8.0 μm untreated Membrane (invasion ... collected from patients immediately after an acute myocardial infarction (AMI) subjected to standard pharmacological therapy Cell Characterization For the immunophenotype, bone marrow and BM-MNC cells...
- 9
- 773
- 0
Báo cáo khoa học: "A multidisciplinary approach for the treatment of GIST liver metastasis" docx
... liver metastases Am J Surg 2003, 185:221-229 Kawasaki S, Makuuchi M, Kakazu T, Miyagawa S, Takayama T, Kosuge T, Sugihara K, Moriya Y: Resection for multiple metastatic liver tumors after portal embolization ... Kubota K, Makuuchi M, Kusaka K, Kobayashi T, Miki K, Hasegawa K, Harihara Y, Takayama T: Measurement of liver volume and hepatic functional reserve as a guide to decision-making in resectional ... mainstay of surgical therapy in primary or metastatic disease is to achieve a complete resection with negative margins [7] Conventional chemotherapy and radiation therapy may have minor adjunctive benefits...
- 4
- 454
- 0
Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt
... without fixation Immediately before FACS analysis µg/ml 7-ADD was added as viability indicator The dot plots shown the total cells in the floating fractions with the CD83+, 7-AAD- and CD83+, 7-AAD+ ... surface area used during the loading process in the bottles allows the monocytes to roll along and stay in close contact with the surface and then eventually attach This is akin to the attachment ... from the original DC donor were also used as stimulators as a control The average cpm and standard deviation of triplicate cultures are shown for each stimulator type static flasks In both cases,...
- 11
- 469
- 0
Báo cáo y học: "A systematic approach for the identification of novel, serologically reactive recombinant Varicella-Zoster Virus (VZV) antigens" ppsx
... codon)-3’ and the “second round PCR” (one -for- all) primer set: One -for- all-forward: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3’ and One -for- all-reverse: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTC-3’ PCR products containing ... in large scale as described by Soutscheck et al [12], rearranged in line assay format and validated with a number of pre-characterized serum samples These validation data confirmed the seroreactivity ... of an indicated therapy After establishing of mass vaccination programmes within many industrialized countries, primary and secondary vaccine failures have occurred in parallel with the observation...
- 9
- 750
- 0
Báo cáo y học: "A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA" doc
... servo head As the disk rotates, a new bit (flux boundary) travels across the receiving boundary area of the servo head and the data are read In the DHD, the DNA can be considered to remain relatively ... the cell As alluded to above, the various types of RNA serve as intermediaries in the translation, access and control of the information encoded on the DNA mRNA is the intermediary data format ... and access of biological information via the DNA transcription machinery One of the limitations of the Central Dogma (and, for that matter, the abstract description of a digital computer as a Von...
- 29
- 420
- 0
Báo cáo sinh học: "Therapeutic dendritic cell vaccine preparation using tumor RNA transfection: A promising approach for the treatment of prostate cancer" pps
... CD80 (a maturation marker) and CD86 (an early maturation marker) Furthermore, the percentage of cells expressing CD 1a and CCR7 was also low These expression levels are in accordance with the pattern ... peptides: a phase II prostate cancer vaccine trial involving patients with hormone-refractory metastatic disease Prostate 1999, 38:73-8 Callegari-Jacques SM, Grattapaglia D, Salzano FM, Salamoni ... very small prostate tumors This, in association with radical prostatectomy and radiation therapies, has contributed to increasing the curative indexes [2] After several years of primary therapy,...
- 7
- 363
- 0
A proteomic approach for the identification of HCC serum biomarkers
... Tanaka et al., 2006; Twu et al., 1993) ; and upregulating amongst other signaling pathways, the Ras-Raf-MAPK signal transduction pathway, the JAK/STAT pathway and the protein kinase B pathway ... autoantigens 73 3.4 MS/MS data of proteins that reacted with normal and patient sera 76 4.1 Autoantigens that make up a TAA panel that enable early detection of HCC as well as risk stratification ... 3.4 THE SEARCH FOR POST-TRANSLATONAL MODIFICATIONS IN THE CIRRHOSIS- AND HCCASSOCIATED AUTOANTIGENS 82 3.4.1 The Search for Phosphorylated Autoantigens 82 3.4.2 The Search for Glycosylated Autoantigens...
- 143
- 269
- 0
A unified approach for the performance analysis of unitary spare time block codes
... to this method As for the remaining patterns, they yield the same mean squared estimation error The MMSE Approach: The decorrelator approach described above can be formuˆ lated as h = Tr, with ... longer applicable and other approaches are needed Such an approach is presented in the next chapter, which presents a unified approach to evaluating the performance of STBC in the presence of channel ... orthogonal design only exist for size × As long as we have an orthogonal design, we can always write the decision statics in the form of (4.3), and the quadratic form approach can be applied 4.4.8 Rate...
- 59
- 240
- 0
Working PaPer SerieS no 1160 / FeBrUarY 2010: evidence For SUrveY maTTerS The eUro area Bank lending emPirical crediT and oUTPUT groWTh pptx
... the sample size are due to the enlargement of the euro area, an increased coverage for Germany and Italy and merger and acquisition activity The country results are summed up to a euro area aggregate ... area real GDP one year ahead Table 11 shows the ordinary least squares estimates by regressing the annual growth in euro area real GDP on a constant and the level of the indicator(s) four quarters ... risk and through all these channels have an impact on output The significant predictive power of the BLS for euro area credit and output remains also when other wellknown leading financial indicators...
- 32
- 509
- 0
WORKING PAPER SERIES NO. 546 / NOVEMBER 2005: THE NATURAL REAL INTEREST RATE AND THE OUTPUT GAP IN THE EURO AREA A JOINT ESTIMATION doc
... whole sample We are grateful to the ECB for providing the data for Germany and the euro area, and Thomas Laubach and John C Williams for providing the US data For the euro area, national levels for ... Giammarioli and Valla (2003) for the euro area, Neiss and Nelson (2003) for the UK and LW for the US, but stands against the results of Cour-Thimann (2004) for the euro area Table 2: Standard ... estimate the natural real interest rate and the output gap in the euro area over the past 40 years Our results suggest that the natural rate of interest has declined gradually over the past 40 years...
- 32
- 578
- 0
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc
... Heyer AG (2010) Mathematical modelling of the central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase on whole plant carbon metabolism ... to the measured leakage values with graphpad prism software Gas exchange measurement Exchange rates of CO2 were measured with an infrared gas analysis system (Uras G; Hartmann & Braun AG, Frankfurt ... of the reduced cosubstrate NADPH For isomerization of fructose 6-phosphate, phosphoglucoisomerase was added 516 Mathematical modelling, parameter identification and simulation A mathematical model...
- 13
- 707
- 0
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc
... 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3¢ The final ratio of target cells was determined by the number of colonies retaining the target gene divided by that of total ... terminator) from pLMZ-WT-H and pLMZ-K3 5A- H using 50-nucleotide primers containing a region homologous to that directly upstream of PHOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG ... recombination at the HOP2 promoter region was amplified from MC-F1 genomic DNA using primers 5¢-AAAAGCGGCCGCTTAAAGCAAGGGTAA ATT-3¢ and 5¢-TTTTGAGCTCATCTTTCAAATAGAGC CTGG -3¢, and inserted into the...
- 9
- 356
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25