osteoporosis a worldwide disease with high economic burden
báo cáo khoa học: " Primary adenocarcinoma of the stomach in von Recklinghausen’s disease with high serum levels of multiple tumor markers: a case report" ppsx
... Internal Medicine, Okayama University, 2-51 Shikata Town, Okayama City, Okayama, 700-8558, Japan 6Department of Surgery, Asahikwa Medical College, 1-1, 2-1 Midorigaoka, Asahikawa, 0788510, Japan ... 2-10, Cyome Nakamachi, Pippu Town Kamikawa-gun, Hokkaido, 078-0343, Japan 2Department of Surgery, Asahikawa Medical Center, 4048, Cyome Hanasaki-cyou, Asahikawa, 0708644, Japan 3Department of Surgery, ... 59(2):145-151 14 Mattar R, Alves de Andrade CR, DiFavero GM, Gama-Rodrigues JJ, Laudanna AA: Preoperative serum level of CA72-4, CEA, CA19-9, and alpha-fetoprotein in patients with gastric cancer RevHosp...
- 5
- 330
- 0
báo cáo khoa học: " Drug Checking: A prevention measure for a heterogeneous group with high consumption frequency and polydrug use - evaluation of zurich’s drug checking services" potx
... during a typical party night with at least one being an illegal substance, such as cocaine, ecstasy, amphetamines or opiates The collected data were analyzed using SPSS statistical software for Windows, ... the data analyses and prepared the first draft of the paper and the final manuscript AB assisted with the interpretation of the data, provided the main background content and provided critical ... on a daily basis was 35% higher in the evaluated sample population than Switzerland’s average number of smokers in 2009 [8] The percentage of daily cannabis consumers (27.2%), which was comparable...
- 6
- 267
- 0
Báo cáo y học: " Experimental ablation of the pancreas with high intensity focused ultrasound (HIFU) in a porcine model"
... Ltd Tokyo, Japan) Statistical analysis Data were expressed as means ± standard deviation (SD), and comparisons were performed with Wilcoxon rank sum test All statistical analyses were carried out ... vacuolated, and mitochondria swelled to a circular shape with a clear matrix and short or disappeared cristae, which were vacuolar appearances Smooth and rough endoplasmic reticulum expanded and became ... The minimal invasiveness and accurate targeting with a real-time US guide allow HIFU to precisely ablate lesions of large size, irregular shape, and even multi-modularity A major advantage of HIFU...
- 7
- 481
- 0
Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3¢fi5¢ direction docx
... cross-react with antibodies against plant helicases including PDH45 and PDH65 and also against human DNA helicases I, II, III and IV (data not shown) ssDNA-dependent ATPase activity was present at a ... 2A, lane 4) and ssDNA-dependent ATPase activity (data not shown) sedimented together between alcohol dehydrogenase and BSA (fraction 11) and gave a molecular mass of 120 kDa with a sedimentation ... substrates (Fig 5G and H) were prepared as described previously [11,15] 32 ATP-dependent DNA helicase and DNA-dependent ATPase assays The standard DNA helicase reaction was performed in a 10-lL reaction...
- 11
- 573
- 0
World Economic outlook 2012: Coping with High Debt and Sluggish Growth pdf
... Australia, Belgium, Brazil, Canada, China, euro area, France, Germany, Hong Kong SAR, India, Indonesia, Italy, Japan, Korea, Malaysia, Mexico, Netherlands, Poland, Russia, Saudi Arabia, Singapore, ... States Brazil Mexico Canada Argentina Colombia Peru Chile Asia Pacific China Japan India Korea Indonesia Australia Thailand Philippines Europe Euro Area Germany Russia United Kingdom France Italy ... Latin America and the Caribbean; MENA = Middle East and North Africa Australia, Canada, Czech Republic, Denmark, euro area, Hong Kong SAR, Israel, Japan, Korea, New Zealand, Norway, Singapore, Sweden,...
- 250
- 401
- 0
Energy and Environmental Problems behind China’s High Economic Growth – A Comprehensive Study of Medium- and Long-term Problems, Measures and International Cooperation pptx
... fast rate of 3,436 km2 a year In addition, arable lands are decreasing by 300 to 600 thousand hectares yearly and deterioration of soils is advancing Natural grasslands are also disappearing ... membership, and initiated Free Trade Agreement talks with ASEAN At the dawn of the new century, China with its huge population of 1.3 billion appeared to be having a good start as an international community ... the water shortage amounts to billion tons a year In total China, the water shortage amounts to as much as 21.8 billion tons nationwide While sandstorms have caused damage to Japan, desertification...
- 5
- 474
- 0
Báo cáo hóa học: " Human cord blood progenitors with high aldehyde dehydrogenase activity improve vascular density in a model of acute myocardial infarction" ppt
... (Methodological) 1994, 56(2):393 22 Fukuchi Y, Miyakawa Y, Kizaki M, Umezawa A, Shimamura K, Kobayashi K, Kuramochi T, Hata J, Ikeda Y, Tamaoki N, et al: Human acute myeloblastic leukemia-ascites ... ALDHloLin- transplanted animals and never in multiple organs of the same animal (data not shown) Engrafting human cells appeared small and round to oval shaped with a small cytoplasm relative to the ... anti-CD31 (1:100, DAKO, Glostrup, Denmark) Staining was visualized using highly crossadsorbed goat anti-mouse or anti-rabbit secondary antibodies conjugated with either Alexa488 or Alexa594 antibodies...
- 13
- 506
- 0
báo cáo hóa học:" The prosurvival activity of ascites against TRAIL is associated with a shorter disease-free interval in patients with ovarian cancer" docx
... necrosis factor-related apoptosis-inducing ligand is associated with favourable ovarian cancer survival Clin Cancer Res 2003, 9:762-766 Kayagaki N, Yamaguchi N, Nakayama M, Takeda K, Akiba H, Tsutsui ... Gaudette DC, Boynton JD, Frankel A, Fang XJ, Sharma A, Hurteau J, Casey G, Goodbody A, Mellors A, Holub BJ, Mills GB: Characterization of an ovarian cancer activating factor in ascites of ovarian ... Furthermore, proteomic analysis of ovarian cancer ascites demonstrated that malignant cells from ascites have higher levels of activated Akt and discriminated malignant ascites and poor survival outcomes...
- 10
- 383
- 0
báo cáo hóa học:" AIDS-associated Kaposi’s sarcoma is linked to advanced disease and high mortality in a primary care HIV programme in South Africa" pdf
... antiretroviral therapy cART Yes 1.0 No 3.4 KS,Kaposi sarcoma HR, Hazards Ratio cART, combination antiretroviral therapy missed, or early cases may have resolved spontaneously on cART without being ... cART and chemotherapy for patients with AIDS-associated KS KS is the most common HIVrelated malignancy and an important contributor to AIDS-related mortality Early diagnosis and improved treatment ... Western Cape, Cape Town 2006 Krown SE, Testa MA, Huang J: AIDS-related Kaposi’s sarcoma: prospective validation of the AIDS Clinical Trials Group staging classification AIDS Clinical Trials Group...
- 5
- 339
- 0
Báo cáo hóa học: " Bilateral pyosalpinx in a peripubescent female with Hirschsprung’s disease: a case report" docx
... genes identified that are associated with Hirschsprung disease and the disease has been associated with other congenital abnormalities Five percent of all cases are associated with Down syndrome ... Inflammation is demonstrated Figure CT scan of the abdomen and pelvis with intravenous and oral contrast Bilateral dilated fallopian tubes with pronounced wall enhancement are shown bilateral ... and a history of Hirschsprung’s disease is extremely rare The pathology and Figure CT scan of the abdomen and pelvis with intravenous and oral contrast Swelling and inflammation are shown around...
- 3
- 293
- 0
Báo cáo sinh học: " Research Article A Contourlet-Based Image Watermarking Scheme with High Resistance to Removal and Geometrical Attacks" pptx
... Lena Elaine Couple City Camera Boat Barbara Baboon 0.4 Boat 0.4 Barbara Normalized correlation (a) Gaussian LPF FMLR (b) Sharpening Reduce color Histogram equalization (a) Zelda Pepper Man Lena ... 0.75 0.7 Test images Zelda Pepper Man Lena Elaine Couple City Camera Boat Zelda Pepper Man Lena Elaine Couple City Camera Boat Barbara Baboon 0.6 Barbara 0.65 Baboon Normalized correlation 0.95 0.55 ... images Test images Gaussian Poisson Elaine 0.75 Couple 0.8 Camera Zelda Pepper Man Lena Elaine Couple City Camera Boat Barbara 0.75 0.85 Boat 0.8 0.9 Barbara 0.85 0.95 Baboon Normalized correlation...
- 13
- 298
- 0
Báo cáo khoa học: " Protection of chickens from Newcastle disease with a recombinant baculovirus subunit vaccine expressing the fusion and hemagglutinin- neuraminidase proteins" pdf
... Gene amplified size (bp) 1,701 1,795 1,719 1,779 Primer sequence 5' TCCAGGTGCAAGATGGGCTCC 3' 5' AGGGAAACCTTCGTTCCTCAT 3' 5' TCAATCATGGACCGCGCCGTT 3' 5' CGCAGAAGATAGGTGATACAA 3' 5' ACATTCAGGACACAATATGGG ... fusion and hemagglutininNeuraminidase antigens Avian Dis 1996, 40, 770-777 Iritani Y, Aoyama S, Takigami S, Hayashi Y, Ogawa R, Yanagida N, Saeki S, Kamogawa K Antibody response to Newcastle disease ... Sumida M, Matsubara F, Aoyama S, Iritani Y, Hayashi Y, Kamogawa K Expression of the Newcastle disease virus (NDV) fusion glycoprotein and vaccination against NDV challenge with a recombinant baculovirus...
- 8
- 315
- 0
báo cáo khoa học: "Development of a duodenal gallstone ileus with gastric outlet obstruction (Bouveret syndrome) four months after successful treatment of symptomatic gallstone disease with cholecystitis and cholangitis: a case report" pps
... the day of admission revealed a normal pancreatic duct and a small pigmented gallstone of the CBD that was extracted with an extraction balloon after endoscopic Page of Table Laboratory data for ... scan and because we were planning a one-stage surgery, we performed a laparotomy instead of choosing a laparoscopic approach Conclusion In a patient with gallstone disease with abdominal pain, ... elevated C-reactive protein (CRP) level of 25.9 mg/dL, mildly elevated plasma aspartate aminotransferase and alanine aminotransferase (AST and ALT) levels of 51 U/L and 83 U/L, a moderate elevation...
- 5
- 272
- 0
Báo cáo y học: "Primary treatment of acromegaly with high-dose lanreotide: a case series" ppt
... Caucasian woman of German nationality presented to our hospital in January 2007 She was diagnosed with acromegaly when an MRI scan showed a large pituitary tumor that was not suitable for surgical ... ultrasonography was not performed She tolerated the treatment well and reported no gastrointestinal discomfort Case report A 63-year-old Caucasian woman of German nationality and with a 40-year ... patients with acromegaly presented in this case series were ineligible for surgery because three of them had macroadenoma that were too large and had parasellar and suprasellar extensions (Patients...
- 6
- 317
- 0
Báo cáo y học: " Impact of prolonged treatment with high-dose ciprofloxacin on human gut flora: a case report" potx
... antibiotics treatment, and the same method was performed There was a marked increase in the Enterobacteriaceae population with E coli at up to × 108 CFU/mL The Gram-negative flora was enriched with Klebsiella ... M100-S16 Wayne, Pennsylvania 2006 Sullivan A, Edlund C, Nord CE: Effect of antimicrobial agents on the ecological balance of human microflora Lancet Infect Dis 2001, 1:101-114 Guarner F, Malagelada JR: ... Bartellini MA: Effects of oral ciprofloxacin on aerobic gram-negative fecal flora in Page of patients with cirrhosis: results of short- and long-term administration with daily and weekly dosages...
- 3
- 353
- 0
Báo cáo y học: " Autosomal dominant polycystic kidney disease with diffuse proliferative glomerulonephritis - an unusual association: a case report and review of the literature" pptx
... also had the disease A general physical examination revealed his blood pressure was 170/110 mmHg and he had bilateral pitting pedal edema A systemic examination of our patient was unremarkable ... 43:131-132 14 Panisello JM, Matinez-Vea A, Garcia C, Carrera M, Oliver JA, Richart C: IgA nephropathy and polycystic kidney disease Am J Nephrol 1988, 8:477-478 15 Hiura T, Yamazaki H, Kawabe S, Ueno ... 5:1349-1354 Dalgaard OZ: Bilateral polycystic disease of kidney A follow up of two hundred and eighty-four patients and their families Acta Med Scand 1957, 328:1-255 Contreas G, Mercado A, Pardo V, Vaamonde...
- 5
- 389
- 0
Báo cáo y học: " Prolactinoma presenting as chronic anaemia with osteoporosis: a case report" pdf
... minimal trauma On examination, he appeared pale with sparse axillary and pubic hair with no galactorrhoea or gynaecomastia On neurological examination there were no visual field defects or cranial ... complete) and infertility are possible presenting features in younger males [1] Hyperprolactinaemia can create a hypogonadic state [2] which is associated with anaemia However, an unexplained anaemia ... and anaemia was merely ascribed to old age Six years later, the anaemia was resolved when the prolactin levels were reduced, making it reasonable to deduce that hyperprolactinaemia was the cause...
- 3
- 275
- 0
Báo cáo y học: " Poly-substance use and antisocial personality traits at admission predict cumulative retention in a buprenorphine programme with mandatory work and high compliance profile" ppt
... was translated and backtranslated into English, and standardized on a nationally representative sample of 5,000 community residents and validated against psychiatric samples with relevant diagnoses ... of antisocial personality disorder and a childhood or adolescent CD develops into an adult ASPD in between 30% and 50% of all cases [8] A recent meta-analysis found that antisocial personality ... [29] and antisocial behaviour [30,31] We first estimated a model for each covariate to describe the univariate relationship between the covariate and retention Further, the proportional hazards assumption...
- 8
- 364
- 0
Báo cáo y học: " A child presenting with acute renal failure secondary to a high dose of indomethacin: a case report" ppsx
... case reports of acute renal failure in children secondary to the administration of a high dose of indomethacin Case presentation The patient was a 20-day-old Spanish male infant with a body weight ... mg/kg/hour The patient had received treatment with vancomycin and amikacin up to days earlier On examination, there was marked generalized edema The initial blood tests revealed a creatinine level ... several factors that could have increased its toxicity, such as renal immaturity due to age and cardiac failure secondary to surgery for the congenital cardiopathy, in addition to edema, hypoalbuminemia...
- 4
- 147
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25