... authorities, the OriginandDevelopmentof Commercial and Islamic Banking Operations 7 (a mixture of gold and silver). This must have encouraged the emergence and practices of banking operations ... ups and downs depending on the political and military conditions of the Republic. In time of wars and disorder, inflation, financial stagnation and bankruptcy prevail and in times of peace and ... the developmentof banking in early Greece was hampered by the level of local economic activity, the severity of local laws and the precarious state of trade and exchange until the invention of...
... Non-ideographic elements of decoration 453 Origin anddevelopmentof form and ornament in ceramic art (W.H. Holmes) 437-465 Origin of ornament in pottery 453 Ornament in pottery, Originof 453-457 ... clay 456 479.—Ornamental use of fillets of clay 456 severed neck, and a handle connects the top of the rim with the back of the vessel. The handle being broken off and the vessel inverted, [Pg ... upon pottery 463 488.—Theoretical developmentof fret work 464 489.—Theoretical developmentof scroll work 465 [Pg 443] ORIGIN ANDDEVELOPMENTOF FORM AND ORNAMENT IN CERAMIC ART. By...
... the University of Technology are of different levels ofEnglish because of their own background. It is common that those who are from big cities and towns have greater ability ofEnglish than ... discrimination of the tests. The results ofEnglish test are not successfully and completely employed. In addition, during the time I have worked as a teacher ofEnglish at the University of Technology, ... taught and at which level ofEnglish they are standing is not paid much attention to. The evaluation only counts for calculating the percentage of the number of students who pass English tests,...
... Kawauchi3 and Kazuyoshi Tsutsui11 Laboratory of Brain Science, Faculty of Integrated Arts and Sciences, Hiroshima University, Japan2 Department of Biochemistry and Molecular Biology, University of ... evolutionary originand divergence of these two groups, by identifying novel RFamide peptides from the brain of sea lamprey, one of only two extant groups of the oldest lineage of ver-tebrates, ... regulation of locomotor activity. In mammals, in situ hybridizationreveals that the nucleus of the solitary tract and dorsalhorn of the spinal cord express the highest levels of themRNA of NPFF,...
... detection of its ligands. Using known lig-ands of I7 OR (heptanal, octanal and nonanal), wesuccessfully demonstrated that they act as agonists asalready experienced in mammalian cells. Odorants of the ... related lig-ands strongly suggests the authenticity of its ligandbinding and the maintenance of the coding ability atthe receptor level. Consequently this suggests that gly-cosylation of I7 OR ... CTCATCTCTGAAGAGGATCTG -3Â) and (5Â- GCATGC CTGCAGGTCGACTCTAGAGGATCTCAAGCCAGTGACCGCCTCCC-3Â), and checked for the presence and sequence of thenew insert, as in the case of pJH2-I7.Plasmids pJH2-I7 and pJH2-OR17-40...
... lombricine (30% of that of taurocyam-ine) and glycocyamine (7% of that of taurocyamine). Neither TK catalyzedthe phosphorylation of creatine. Comparison of the deduced amino acidsequences of mitochondrial ... 3381–3385.Cytoplasmic and mitochondrial taurocyamine kinases K. Uda et al.3530 FEBS Journal 272 (2005) 35213530 ê 2005 FEBS Originand properties of cytoplasmic and mitochondrialisoforms of taurocyamine ... correlations of this relaxed sub-strate specificity and the possibility of cytoplasmic and mitochondrial isoforms of TK, we have amplified twocDNAs coding for Arenicola brasiliensis TKs and cloned...
... 33Milk and dough development Z70 to Z89 33Ripening Z90 to Z99 33THE WHEAT BOOK CHAPTER 2 – THE STRUCTURE ANDDEVELOPMENTOF THE CEREAL PLANT23CHAPTER TWOTHE STRUCTURE AND DEVELOPMENTOF THECEREAL ... available inthe literature for a wide range of environments. Analyses of these data sets show average water loss of the order of 100-110 mm and average water use efficiencies of the order of 16 kg/ha/mm. ... the ear and stem grow rapidly.Associated with this growth is the formation of floretswithin each spikelet and, later, the regression and death of some florets and spikelets and the death of some...
... 4πa2, and is zero atthe ‘antipole’ (χ = π). In such a space the value of S(χ) is more than in Euclideanspace, and the sum of the internal angles of a triangle is more than π. The prop-erties of ... Fundamentals of General RelativityThe strongest force of nature on large scales is gravity, so the most important part of a physical description of the Universe is a theory of gravity. The best candidatewe ... theories of structure formationusing statistical properties of galaxy clustering, the fluctuations of the cosmicmicrowave background, galaxy-peculiar motions and observations of galaxy evo-lution and...
... C, to be of negligible mass and for the ratio of the masses of A and B to exceed 25. In such cases small displacements of body C from L and L do not become unbounded and, of course, A and B ex-ecute ... by(1.9)in which the left-hand side is the negative of the self-gravitational energy of auniform sphere of mass and radius . Expressing mass in terms of density, , and radius and rearranging one finds(1.10)Inserting ... plausible mechanism for the originof the solar system and their strengths and weaknesses are analysed. The only theory to essay a com-plete picture of the originand evolution of the solar system is...
... samples.For an exploration of the proteolytic system of PrtA, and an understanding of its role in the infectionprocess of Photorhabdus, we needed a highly sensitive and specific substrate to selectively ... the development of such a substrate based on analysis of PrtA cleavagesite specificity, and kinetic characterization of PrtAactivity on the new substrate.Results and DiscussionIdentification of ... in our measurements), and Aex and Aemare the absorbance of the sample solutionat the excitation and the emission wavelengths.Mesurement of PrtA activity and specificity of the Dabcyl–EVYAVES–Edans...
... if, say on considerations of frequency of occurrence, do exceptions were externally handled and the infrequent Table 2: Incremental k-reversible inference of some English auxiliary verb sequences. ... because English verb sequences are highly regular, yet they have some degree of complexity and admit to some exceptions. We represent the English auxiliary system am a corpus of 92 variants of ... OVERGENERALIZATION OF THE ENGLISH AUXILIARY SYSTEM bread Figure I: The top automaton generates the English auxiliary system. Zero-reversible inference merges state 3 with state 2 and merges states 7 and...
... amplitudes and must therefore be amplified before their processing and display can be accomplished. Thespecifications and lists of characteristics of biopotential amplifiers can be as long and con-fusing ... afinite period of time and then drifts back to the original baseline. The time required for thereturn of normal operational conditions of the biopotential amplifier after the end of thesaturating ... advantages and disadvantages, and it is thedesigners task to find a suitable compromise that best fits the task at hand. Table 2.5 sum-marizes the frequency- and time-domain characteristics of these...
... provide the unity of the studies and practice; the ESP course has to further the developmentof students’ knowledge of professional lexis and the developmentof their listening and speaking skills, ... theoretical literatureand sources on curriculum and syllabus design, the components anddevelopmentof general competence, professional competence, the English language competence and ESP competence; ... the English language both receptively and productively in communication and professional work, responsibly develop tourism industry and offer the client a product in an understandable and...