once solver has found a solution choose save scenario from the dialog box the scenario can be named and either the new values kept or the original values restored
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
Ngày tải lên :
16/02/2014, 09:20
... initial detection and isolation of NRPs [20] Furthermore, this approach substitutes the CAS assay-guided fractionation and enabled the scale-down of NRP discovery from a preparative to analytical ... Erythrochelin siderophore characterization 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) Foroxymithine, a new inhibitor of angiotensin-converting ... Extraction of the supernatant followed by radio-LC-MS analysis revealed the radiolabeling of a compound with a measured m ⁄ z of 604.27 [M+H+] (Fig 3A) The incorporation of radiolabeled l-Orn was...
- 14
- 614
- 0
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf
Ngày tải lên :
21/02/2014, 03:20
... indicates the absorption maximum of the a band at 557 nm absorption maxima at 420 nm (c band), 530 nm (b band) and 557 nm (a band) are characteristic of cytochrome b Heme was extracted from the ... g values at 2.031, 1.994, and 1.951 The resonance started to develop at potentials ‡ mV and was stable at potentials up to +350 mV The loss and formation of the resonance was associated with a ... characteristics very similar to a unique signal described for Hdr from methanogens The two paramagnetic species have similar g values, show the same temperature behavior, and are only detectable...
- 10
- 564
- 0
Báo cáo khoa học: A novel metallocarboxypeptidase-like enzyme from the marine annelid Sabellastarte magnifica – a step into the invertebrate world of proteases pdf
Ngày tải lên :
07/03/2014, 02:20
... Annelida, Class Polychaeta, Subclass Palpata, Order Canalipalpata, Suborder Sabellida, Family Sabellidae, Genus Sabellastarte [14] The ‘tentacle crown’ and the ‘body’ parts of the animal are clearly ... granulifera, Cassiopea xamachana, Condylactys gigantea, Gorgonia ventalina, Lebrunia danae, Palythoa caribaeorum, Physalia physalis, Plexaura homomalla, Stichodactyla helianthus and Zoanthus pulchellus); ... Proteomica, and particularly from Drs A Paradela (ProteoRed Madridnode) and M Carrascal (ProteoRed Barcelona-node) The authors are also grateful to Kamela Alegre (IBB, Universitat Autonoma de Barcelona,...
- 16
- 628
- 0
Báo cáo Y học: Characterization of a low redox potential laccase from the basidiomycete C30 pptx
Ngày tải lên :
08/03/2014, 09:20
... dyes supports this idea The C30 laccase isoforms we have detected so far all have an apparent molecular mass close to 65 kDa and, except for a still-uncharacterized laccase, are all acidic proteins ... from lac1, the gene encoding LAC1, and clac2, the cDNA encoding LAC2, are 69% identical and the two proteins, LAC1 and LAC2, present very similar optical and EPR spectra Generally speaking, all ... pI ranging from 3.2 (LAC2) to 3.6 (LAC1) [15] The optimum pH for syringaldazine oxidation is close to 4.5–5 for LAC1 and 5.5–6 for LAC2, values that, unlike the data obtained for several laccases...
- 7
- 616
- 0
Báo cáo khoa học: Shewasin A, an active pepsin homolog from the bacterium Shewanella amazonensis pptx
Ngày tải lên :
14/03/2014, 22:20
... (Stratagene, La Jolla, CA, USA) was used to generate the active site mutant shewasin A_ (D3 7A) in the vector pET2 8a, using the primers 5¢-AGCGTGAACCTGATTATTGCGA CCGGCAGCAGCACCCTG-3¢ (forward primer) ... shewasin A at pH Analysis by MS revealed that the primary cleavage site was at Leu*Phe (* indicates the cleavage site), with a further minor cleavage occurring at the adjacent Phe*Val (Table ... [7] The remaining families of APs in the MEROPS database (A1 , A2 , A3 , A9 , A1 1, and A3 3) all belong to only one clan (AA), with their members being readily identified by the presence of characteristic...
- 10
- 568
- 1
A SMALLER HISTORY OF GREECE from the earliest times to the Roman conquest doc
Ngày tải lên :
15/03/2014, 07:20
... Isagoras as a tyrant over the Athenians, and at the same time he concerted measures with the Thebans and the Chalcidians of Euboea for a simultaneous attack upon Attica The Peloponnesian army, ... to the DORIANS and AEOLIANS; and Xuthus; through his two sons Ion and Achaeus, became the forefather of the IONIANS and ACHAEANS Thus the Greeks accounted for the origin of the four great divisions ... were Achaia, Argolis, Laconia, Messenia, and Elis ACHAIA is a narrow slip of country lying between the northern barrier of Arcadia and the Corinthian gulf ARGOLIS, on the east, contained several...
- 233
- 390
- 0
Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx
Ngày tải lên :
16/03/2014, 10:20
... Russia, eastern Asia, Australia, and New Zealand, and has the potential to transmit pathogens including viruses, rickettsia and protozoan parasites that cause important human and animal diseases ... (resurrected) of Australia, New Zealand, New Caledonia, Fiji, Japan, Korea, and Northeastern China and USSR, and its parthenogenetic and bisexual populations (Ixodoidea, Ixodidae) J Parasitol 54, 1197–1213 ... potential biochemical pathways We describe here the cloning and partial characterization of a cDNA encoding a SCP from the ixoidid tick Haemaphysalis longicornis, which has a wide geographical distribution...
- 14
- 432
- 0
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx
Ngày tải lên :
16/03/2014, 14:20
... using the primers BG1279 (5¢-GCGCG CCATGGCATCCGAGAAGATGGTTGCTATCA, sense) and BG1297 (5¢-GCGCGGGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense), containing NcoI and BamHI sites (underlined in the ... Invitrogen (Paisley, UK) and New England Biolabs (Ipswich, MA, USA) Pfu Turbo and T4 DNA ligase were purchased from Invitrogen and Stratagene (Amsterdam, the Netherlands), respectively For heterologous ... Authors Journal compilation ª 2006 FEBS R Machielsen and J van der Oost 14 Higashi N, Matsuura T, Nakagawa A & Ishikawa K (2005) Crystallization and preliminary X-ray analysis of hyperthermophilic...
- 8
- 415
- 0
CHILD HEALTH CARE DEMAND IN A DEVELOPING COUNTRY: UNCONDITIONAL ESTIMATES FROM THE PHILIPPINES doc
Ngày tải lên :
28/03/2014, 09:20
... At each pass (called a replication), the estimator is applied to the data and the resulting parameter estimates are saved as a data set Using the collection of estimated parameter sets from these ... splines; these include child age, mother and husband education, mother height, and household asset values Spline transformations provide a way to assess the relationship between an explanatory variable ... temperature, and present and lagged values of rainfall 18 We use sanitation information aggregated to the barangay level because household decisions concerning sanitation are important for child...
- 101
- 298
- 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx
Ngày tải lên :
31/03/2014, 15:20
... ´ against the acidic autoxidation must have been produced by the formation of the a1 b1 or a2 b2 contact To see more quantitatively the effect of the a1 b1 or a2 b2 contact on the autoxidation reaction, ... tetramer, too All these features were essentially the same at other pH values as seen in Tables and Certainly, the biphasic nature of the autoxidation rate became much less steep at pH 7.5, and ... have the spectral changes that can be ascribed to the autoxidation of the b chains alone Such computations have disclosed that the reaction started from the fully oxygenated b chains with an absorbance...
- 10
- 648
- 0
báo cáo hóa học: " Development and validation of a preference based measure derived from the Cambridge Pulmonary Hypertension Outcome Review (CAMPHOR) for use in cost utility analyses" doc
Ngày tải lên :
18/06/2014, 19:20
... designed and managed the valuation survey, analysed and reported on the valuation data and contributed to the writing of the manuscript All authors read and approved the final manuscript Acknowledgements ... technique, as was the case for the CAMPHOR and EQ-5D models, then the valuations should be comparable [25] The valuation exercise found that the best state defined by the CAMPHOR items was below It ... corresponding value for that health state according to the recommended model is 0.465 All other health state classifications arising from the CAMPHOR can be valued using the same approach The CAMPHOR preference-based...
- 8
- 590
- 0
báo cáo hóa học: " Internal construct validity of the Warwick-Edinburgh Mental Well-being Scale (WEMWBS): a Rasch analysis using data from the Scottish Health Education Population Survey" potx
Ngày tải lên :
18/06/2014, 19:20
... scales based on ordinal data, it has been argued that both the latter approaches are inappropriate, given that factor analysis is parametric and requires interval scaling, and Cronbach's Alpha ... AT carried out all the statistical analyses and produced the first draft of the manuscript RT designed and coordinated the study SP participated in the design and coordination of the study, and ... items displaying DIF would be prime candidates for removal in any scale revision [27] Sometimes bias may cancel out in the test, for example, one item may favour males, another females, and their...
- 8
- 462
- 0
báo cáo hóa học:" Cross-diagnostic validity in a generic instrument: an example from the Functional Independence Measure in Scandinavia" docx
Ngày tải lên :
20/06/2014, 15:20
... explored graphically by comparing the raw-score to logit transformation graph for each test, and tables are produced for the raw score logit estimate values, which can be exported for further analysis ... (SCI) data came from Denmark and data on patients with TBI from Sweden The Scandinavian countries have a common socio-cultural background The health care system is very similar with taxed financed ... sclerosis They used Rasch analysis with the Rating Scale Model (RSM) and anchoring using the threshold measures of the whole group The original FIM™ motor scale is not a true ordered category scale and...
- 8
- 301
- 1
báo cáo khoa học: " Validity and usefulness of members reports of implementation progress in a quality improvement initiative: findings from the Team Check-up Tool (TCT)" pot
Ngày tải lên :
10/08/2014, 11:20
... care In addition to teamwork, leadership support and available resources may be important context variables However, team functioning, leadership and organizational support can vary across teams ... acquired the data, performed all statistical analysis, and participated in data interpretation and drafting of the paper LHL participated in conceptualization and design of the study and provided ... five behaviors Unit-level performance for a behavior was indicated if the member reported most or all of unit staff consistently performed the activity A summed score was then calculated as the...
- 13
- 312
- 0
báo cáo khoa học: " How is Telemedicine perceived? A qualitative study of perspectives from the UK and India" pps
Ngày tải lên :
11/08/2014, 14:21
... literature and analysis of a role for bi-lateral trade Chanda R: Trade in Health Services: Opportunities and Constraints under an India-EU Trade and Investment Agreement Report prepared for the ... services, the key sectors being diagnostic (mainly tele-radiology and tele-pathology), concerns regarding quality and litigation, the main advantages being saving time and money from the UK side, and ... tele-care initiatives in remote parts of Scotland and Canada The growing use of telemedicine has prompted a body of literature on the benefits and concerns associated with it The authors have previously...
- 7
- 338
- 0
báo cáo khoa học: " Switching to smokeless tobacco as a smoking cessation method: evidence from the 2000 National Health Interview Survey" pot
Ngày tải lên :
11/08/2014, 18:20
... national adult male smoking prevalence Comparison of ST and pharmaceutical nicotine in a regulatory, legal and social context further suggests that the potential of ST as a cessation aid has been ... addition, major efforts have been made by the American tobacco control community to impede any widespread transition from cigarettes to ST [1,18] Despite the pro-pharmaceutical and anti-ST climate, an ... ST compares very favorably with pharmaceutical nicotine as a quit-smoking aid among American men, despite the fact that few smokers know that the switch provides almost all of the health benefits...
- 7
- 303
- 0
Báo cáo khoa học: " A geminiviral amplicon (VA) derived from Tomato leaf curl virus (ToLCV) can replicate in a wide variety of plant species and also acts as a VIGS vector" pps
Ngày tải lên :
12/08/2014, 04:20
... to be generated and replicated in plants like tomato, tobacco (Nicotiana xanthii), Arabidopsis thaliana and rice (Oryza sativa, variety Pusa Basmati) We also show that the mutation in either AC2 ... (VA) and various mutants [VA(AC2M), VA(AC4M) and VA(AC2MAC4M)] of VA/ToLCV constructs in tomato plants (A) Total DNA was isolated from the tomato leaves agroinfiltrated with VIGS, VA(AC2M), VA(AC4M) ... 5'ATGAGCTCATGGCAAGTAAAGGAGAAGAAC-3', and Reverse: 5'-CGGGATCCGAGCTCTTAGAGTTCGTCGTGTTTG-3' The amplified fragment was cloned in the forward orientation in VA/pCAMBIA1391Z, as obtained above, at SacI sites The...
- 13
- 428
- 0
Báo cáo y học: " Sputum neutrophils as a biomarker in COPD: findings from the ECLIPSE study" pdf
Ngày tải lên :
12/08/2014, 11:22
... induction was performed in a subset of patients recruited at 14 sites as follows; Lebanon, Denver, Omaha and Hartford (all USA), Halifax, Sainte-Foy, Montreal and Hamilton (all Canada), Bergen (Norway), ... Pharmaceuticals, AstraZeneca, CIPLA, Novartis Forest, MSD, Boehringer and Allmiral LE and RT are employees of GSK SR has consulted or participated in advisory boards for: Able Associates, Adelphia ... assess the burden of airway inflammation; it is not a major surrogate of the other clinical and pathophysiological abnormalities measured in this study Generally, any weak but significant associations...
- 12
- 379
- 0
Báo cáo y học: "Antiviral activity of a-helical stapled peptides designed from the HIV-1 capsid dimerization domain" pps
Ngày tải lên :
13/08/2014, 01:20
... analyzed the ITC data and written part of the manuscript; DC, analyzed the NMR data and written part of the manuscript; EOF analyzed the data and written and edited the manuscript, AKD conceived the ... microscopy, isothermal titration calorimetry and sedimentation equilibrium analyses and analyzed data; FC carried out the antiviral assays and analyzed data; XZ helped in preparing and purifying ... performed all NMR related studies, analyzed the data and written part of the manuscript; AAW performed the study on HIV and EIAV assembly and release, prepared the corresponding figures; AC, analyzed...
- 18
- 232
- 0