oliver s exhibiting decided marks of genius becomes a public character in the metropolis
Tài liệu Báo cáo khoa học: "An ISU Dialogue System Exhibiting Reinforcement Learning of Dialogue Policies: Generic Slot-filling in the TALK In-car System" pot
... OMMUNICATOR dialogue actions and in- car dialogue actions, for each sub-task type of the in- car system 121 Note that we treat each of the in- car sub-tasks (hotels, restaurants, bars) as a separate slot-filling ... filling on the C OMMUNICATOR data set can be abstracted and used in the in- car scenarios The In- car” Scenario The scenario we have designed the system to cover is that of information seeking about ... Map interface (a java OAA agent), Database agent (java OAA wrapper to MySQL) 5.1 Dialogue Policy Learner Agent This agent acts as an interface between the DIPPER dialogue manager and the system...
- 4
- 394
- 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
... measured in a luminometer (Turner Designs, Sunnyvale, CA, USA) The b-galactosidase level in each sample was estimated by comparison to a b-galactosidase standard curve to adjust luciferase activity ... CGGGAACCACTATGCC ACACAAAGCCACTGAA (V) CCCTTCTTGCCATCG (I) GCCGGTTATTTCATAGACAC (II) AAGACGTTTAGGTGCAAT (III) CCCTTTGCTGTTGGAT (IV) TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG ... samples were adjusted to equal protein concentrations PKA phosphotransferase activity was measured against the substrates kemptide (Leu-Arg-Arg-Ala-Ser-Leu-Gly, Sigma-Aldrich) and histone H1 (Sigma-Aldrich)...
- 13
- 344
- 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
... This suggests that the signaling pathway from the IFN-c receptor to the acyltransferase involves tyrosine kinases but not protein kinase C Such a finding is not unexpected as the Janus family of ... other acyltransferases) is a key regulator of both the priming of monocytes by IFN-c and for LPS-initiated TNF -a release Materials and methods Materials Unless stated otherwise, all reagents ... cytokine responses to LPS Our results suggest that acyltransferases play a key role in the production of in ammatory cytokines from LPSstimulated monocytes our findings support those of Yamada et al.,...
- 7
- 322
- 0
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx
... b-gal cat cells SH-SY5Y cells stably transfected with the plasmid containing b-galactosidase cDNA (b-gal) Western blot analysis revealed a significant 1.6-fold increase in a- synuclein expression ... significant changes as a consequence of a- synuclein overexpression or as a result of the association of dopamine treatment with a- synuclein overexpression (Fig 3B) The same analysis performed on all ... a cellular model of a- synuclein overexpression, the human neuroblastoma cell line SH-SY5Y was stably transfected with the plasmid containing human a- synuclein cDNA (a- syn) As a control, we used...
- 11
- 775
- 0
Tài liệu Company ''''A'''', corps of engineers, U.S.A., 1846-''''48, in the Mexican war doc
... relieved the Captain at the gangway and superintended the embarkation of the men in that boat The Captain was lowered over the side of the vessel in a chair; and I, when all else was ready to pull off, ... naval officer in charge of the surf boats, and in my name, request that Captain Swift be taken as soon as practicable, to the steamer which was the headquarters of General Scott That request was ... officers in supervising the construction of batteries against Chapultepec I was placed in charge of Battery No 1, on the Tacubaya road, against the southern face of the Castle; and Lieutenant McClellan...
- 48
- 504
- 0
Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''s disease" docx
... (SLE), systemic sclerosis (SSc), various forms of primary vasculitis as well as in patients with diseases that share clinical features with BD, such as inflammatory bowel disease and uveitis Finally, ... the protein Sip1 Sip1 is a nuclear splicing factor containing an arginine/serine-rich domain and a RNAbinding motif that may play a role in linking the processes of transcription and pre-mRNA ... manufacturer 's instructions Statistical analysis Chi-square analysis was used to evaluate differences between percentages; Kruskal Wallis non-parametric ANOVA test and the Mann-Whitney unpaired...
- 8
- 550
- 0
Báo cáo y học: "Association of the T allele of an intronic single nucleotide polymorphism in the colony stimulating factor 1 receptor with Crohn''''s disease: a case-control study" ppt
... bacterial cell walls, and triggers a cascade of signaling events resulting in the activation of NF-kappa B and the host innate immune system [4] NOD2 is expressed in monocytes and in intestinal epithelial ... calculated using SAS software (SAS, Cary, NC) Page of (page number not for citation purposes) Journal of Immune Based Therapies and Vaccines 2004, Results Association of the T allele of the A2 033T SNP ... hypothesize that the CSF1R protein plays a role in differentiation of intestinal epithelial cells as it does in macrophages The most intense cytoplasmic staining occurred in the terminal web of the...
- 8
- 294
- 0
Regulation of DNA (cytosine 5) methyltransferase 1 in the cell cycle and its role(s) in doxorubicin mediated micronuclei formation
... 5-Aza-cytidine 5AzadC 5-Aza-deoxycytidine A. thaliana Arabidopsis thaliana aa amino acids mAb monoclonal antibody pAb polyclonal antibody ATCC American Tissue Culture Collection avg average bp basepairs ... Host defense versus DNA methylation Cytosine methylation is part of a genome defense system involved in the inactivation of parasitic sequences such as transposable elements and proviral DNA, and ... methylation in plants and mammals, and all cytosine methylation in the ascomycete fungus Neurospara crassa, reside in repetitive elements such as transposons (Goll and Bestor, 2005; Smit and Riggs,...
- 208
- 387
- 0
Báo cáo y học: " the Value of Serum Biomarkers (Bc1, Bc2, Bc3) in the Diagnosis of Early Breast Cancer"
... was calculated by counting the areas where the nuclear staining was the highest Statistical Analysis Spectra data were transferred to a data processor and software capable of analyzing univariate ... biomarkers for early diagnosis of the disease Many studies have shown that several proteins change in cancer These changes may cause measurable alterations and secretion of marker proteins to ... provided that the staining is intense (++) Score 3: Presence of intense staining surrounding the whole cytoplasmic membrane in at least 30% of invasive cells (+++) Scores and were accepted as negative,...
- 8
- 584
- 0
Improvement of nutrient removal and phosphorus recovery in the anaerobic/oxic/anoxic process combined with sludge ozonation and phosphorus adsorption
... phosphorus concentration increased in the anaerobic phase due to phosphorus release from PAOs Part of the released phosphorus was then accumulated in the sludge in the subsequent oxic tank by normal ... 16% of total MLSS per day (Phase 2), and as a result, MLSS concentration was maintained at around 3,000 mg/L Figure Time course of TOC, T-N, and T-P concentrations in the effluent and MLSS in the ... rural wastewater, which was collected from a rural sewage treatment plant daily, was flowed into the system The characteristics of the influent wastewater were as follows: 160–200 mg/L of SS, 55–80...
- 8
- 916
- 1
Evaluation of the Characteristics of Microorganisms that Contribute to Denitrification in the Paddy Drainage Treatment Apparatus by Quinone Composition Measurement
... MK-8(H2) These menaquinones are also the major ones in activated sludge (Hiraishi et al., 1996) The molar ratio of menaquinone to ubiquinone (MK/Q) is used as an indicator of the respiratory state such ... weir, and water levels in the paddy field and the apparatus remained approximately constant during the observation period A mid-summer drainage was not carried out Harvesting was carried out in late ... component analysis (PCA) for DNR was carried out using the fourteen identified quinones, three ubiquinones and eleven menaquinones as variables Fig shows a graphic representation of the PCA analysis of...
- 7
- 570
- 0
Performance of Jatropha curcas: A biofuel crop in wasteland of Madhya Pradesh, India
... leaves during the dry season and attains a height of about meters in years [7] Preparations of various parts of the plant have been used in traditional medicine and as pest repellents The most ... T7 and T1) but fruit formation was not observed 2.5 Data analysis The data were subjected to statistical analysis using mean values, ANOVA, simple correlation and summary statistic using Statistix ... Genotype sources Dewari Sagar Dewari Sagar Samaria Depot Sagar Samaria Depot Sagar Bizouli Janarpura Gwalior Bizouli Janarpura Gwalior Bizouli Janarpura Gwalior Bizouli Janarpura Gwalior Bizouli Janarpura...
- 10
- 345
- 0
Regulation of navigation and vessel-source pollution in the Northern Sea Route - Article 234 and state practice
... declarations have included protests against Russian Arctic baselines and objections to the application of the Russian legislation for the NSR to state vessels.17 Both the USA and Russia invoke national ... ice-covered straits, equally so regarding those in the Russian and Canadian Arctic.15 In the US view, the Russian Arctic straits are international and thus subject to transit passage.16 In addition, US ... probably meant to be interpreted in a non-discriminatory manner ‘against’ all vessels – the coastal state s flag vessels as well as the vessels of any other state It might be argued that it is not...
- 23
- 555
- 0
A contrastive analysis of encouraging as a speech act in english and vietnamese
... number of strategies in business plan, saying sorry, attending summer holiday situations Meanwhile, VNS used greater number of strategies in interview preparation and familiar situations than in the ... English In fact, in learning English as a foreign language, the Vietnamese learners of English usually apply what they have accumulated from the various textbooks As a result, in some cases, they ... Natural Language Understanding, Lawrence Erlbaum Associates, Publishers, Hisdale, New Jersey Hove and London.”[43] In the book, the author discusses the foundations of the analysis of language...
- 13
- 1,583
- 8
The victorious laugh of love, frienship, justice and commonsence in the merchant of venice by shakespeare
... humanism in the Renaissance The humanism was the progressive ideology creating all spiritual values of the Renaissance Human life, the happiness of people and the beliefs in man 's abilities became ... Landowners drove thousands of peasants out of their lands , turning these lands into pastures , or "enclosures " for sheep There was no work for the peasants and many of them became homeless beggars The ... people 's language , folk stories and songs These left fresh images in his later works Shakespeare is the third of Jonh Shakespeare who was the prosperous tradesman and merchant and a person of some...
- 47
- 437
- 0
Focus - A simplicity manifesto in the Age of Distraction
... pleasure rush and making you want to the activity again, as soon as possible You get the positive reinforcement again, and again, and again, in a constant cycle of positive reinforcement, and soon ... our lives So the key to beating these fears is to face them Be honest — what are you afraid of? Then shine a light on these fears with actual facts — what harm has actually been caused so far? Try ... updates of news sites Being connected all the time, being part of this constant stream of distraction, is an expectation that society now has of us And going against that expectation is immensely...
- 121
- 552
- 1
Tài liệu Báo cáo " Assessment of climate change impacts on flooding in the downstream of the Dong Nai River " pptx
... flooding in Sai Gon – Dong Nai river basin The software is integrated from the hydraulic mathematical models, material conservation and database management models in GIS formats The data used in the ... between all scenarios are not dramatic The results also showed that as sea level rise together with the increase in rainfall, the difference in inundated areas between scenarios B1, B2 and A1 FI are ... rainy seasons resulting in a negligible changes in discharge in the Dong Nai river basin With respect to the highest floods in each computation phases, the differences in total discharge of the...
- 7
- 527
- 0
Tài liệu Guidelines for the appointment of General Practitioners with Special Interests in the Delivery of Clinical Services pdf
... local specialist) and/or national (representative from Professional body or Special Interest Primary Care Organisation) assessors, where at least one assessor has in- depth specialist knowledge of ... Appropriate sensitive and specific diagnosis tests for Chlamydia and other STIs Access to health advisor Clear sign-posting in the waiting room and practice leaflets to sexual health service available ... multiprofessional and disciplinary learning Close links with specialist colleagues and others working in the field is important for maintenance of competencies In order to maintain skills and expertise,...
- 11
- 489
- 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx
... communicable diseases Between these two groups there is no sharp line of division, and in some cases, certain species possess the faculty of growing either as parasites or saprophytes, in which case ... one species from another As far as these characters can be used, they are taken, but in addition, many characteristics of a physiological nature are added The way that the organism grows in different ... carbon are most available in the form of organic compounds, such as albuminous material Carbon in the form of carbohydrates, as sugar or starch, is most readily attacked by bacteria Inasmuch as...
- 201
- 540
- 0
Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx
... anti-(mouse Igs) and the alkaline phosphatase-antialkaline phosphatase (APAAP) conjugate, as described in Methods Color was developed with Fast-Red substrate Images showing CD1d expression in HepG2 ... media We have also shown that the increase in the prooxidant state caused by iron loading has an impact in protein integrity, as indicated by an increase in protein-bound acrolein adducts at the ... of phosphatidylserine at the outer part of iron-loaded HepG2 cells was increased, and double-labeling revealed that the increase in phosphatidylserine expression was of the same order of magnitude...
- 14
- 682
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25