offset the cursor to the end of a search match
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx
... determined numerical values of the ratio a/ b, and is the theoretical numerical value of ratio a/ b for a mixture of aromatic amino acids (Tyr and Trp), containing the same molar ratio as the protein ... not mark any as poor or inappropriate Another structural analysis, obtained by the VERIFY3D program [61], gave an average value of 0.21, which is greater than zero, the quality value indicated ... and therefore a positive value indicates better than average and their maximum values are around The values for all these parameters obtained for the PsbQ model were quite good and the programs...
- 12
- 550
- 0
Báo cáo sinh học: "Functions of O-fucosyltransferase in Notch trafficking and signaling: towards the end of a controversy" pptx
... in the light of a speculative model of the transcytosis of Notch to suggest that Ofut1 acts in a catalysis-dependent manner to regulate the transcytosis of Notch [12] We feel that this transcytosis ... ponent of Notch signaling pathways Proc Natl Acad Sci USA 2003, 100:5234-5239 12 Sasaki N, Sasamura T, Ishikawa HO, Kanai M, Ueda R, Saigo K, Matsuno K: Polarized exocytosis and transcytosis of Notch ... from the ER Thus, Ofut1 probably acts as a chaperone in the ER to promote the proper folding of the extracellular domain of Notch, as described in model Although the catalytic and non-catalytic activities...
- 5
- 419
- 0
Báo cáo y học: "NICE-SUGAR: the end of a sweet dream" pdf
... AH, Quintero AM, Gonzalez LG, Saldarriaga NE, Bedoya M, Toro JM, Velasquez JB, Valencia JC, Arango CM, Aleman PH, Vasquez EM, Chavarriaga JC, Yepes A, Pulido W, Cadavid CA, Grupo de Investigacion ... some standards of care will be changed The Endocrine Society has already issued a statement [10], just after the publication of the results of NICE-SUGAR, advocating the need for more nuanced ... insulin therapy in the critically ill patients N Engl J Med 2001, 345:1359-67 Arabi YM, Dabbagh OC, Tamim HM, Al-Shimemeri AA, Memish ZA, Haddad SH, Sved SJ, Giridhar HR, Rishu AH, Al-Daker MO, Kahoul...
- 3
- 290
- 0
a guide to the end of the world everything you never wanted to know sep 2004
... well after the bell has rung and the athletes are hurtling down the final straight of the last lap As they battle for the tape, dinosaurs appear and then disappear while the leaders Page A VERY ... latter causing damage totalling 35 billion US$ -the costliest natural disaster in US history Just a year later, a magnitude 7.2 quake at the western margin of the Pacific plate devastated the Japanese ... tsunamis The latter are generated when a quake instantaneously jerks upwards-perhaps by just a metre or so- large area of the seabed, causing the disa placed water above to hurtle outwards as a...
- 212
- 445
- 0
greer - the long descent; a user's guide to the end of the industrial age (2008)
... corners of the Yucatan right up to the Spanish conquest The End of the Industrial Age 27 Map the Maya collapse onto human lifespans and the real scale of the process comes through A Lowland Maya woman ... is to understate matters considerably One of the many ironies of these debates is that while the EIA and other government agencies massaged the data, the peak oil message had already found an audience ... you can divert a large share of the ethanol to power tractors and combines, or you can divert a large share of the corn to feed horses and farmhands — but one way or another, you have to factor...
- 273
- 286
- 0
The text doesn’t stop at the end of the page (or does it) an exploration of how the novel form responds to digital interactivity through the cross sited novel ‘once in a lifetime
... something about him, I let out a mighty Graham Kennedy-style “Faaaaaaaark,” pressed eject and threw the tape out of the window The next tape that came to hand was The Eagles, and of course it was cued ... was ideally suited to a position in the Top Office as they called it – couldn’t they see that I had no idea what I was doing? I sat there in the General Manager’s office listening to him and the ... I’d have to pay so there went next week’s wages already A barrage of applause brought me back I clapped too I trudged out into the foyer Dan waved me over “That was great Dan,” I said with real...
- 317
- 311
- 0
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc
... have the help of sophisticated information systems and data warehouses been able to manage a great deal of data The challenge is to capture and measure soft and qualitative information For example, ... Skandia Navigator (Edvinsson and Malone, 1997) Value Chain Scoreboard (Lev, 2002) Description of measure Sets of human capital indicators are collected and bench-marked against a database Similar to ... predominantly classical ones We can find the explanation for this behaviour in the fact that these indicators are much easier to measure In addition, conventional methods have the advantage of being...
- 15
- 796
- 0
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf
... success factors are valid for any type of strategy It is possible that the quality of the strategy established in a firm can be measured via these same factors, even if the individual case is a strategy ... knowledge of the environment, markets and customers The second fundamental aspect in the Irizar strategy was that of shared leadership The idea that the best organizations not depend on great leaders’ ... Irizar Brazil and Irizar Mexico, with a shareholding in International Hispacold, all to be able to service the growing demand in these markets At the same time, a systematic application of KM was...
- 10
- 1,063
- 1
Tài liệu Exporting the Results of a Query to an Array pdf
... from the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the ... Object[][] tableArray = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and ... = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection of rows in the...
- 5
- 309
- 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
... was improved by con˚ sidering only pairs of Ca atoms < 2.5 A apart Because of the different length of a helix A, the Ca atoms N-terminal to or inside helix A are separated by large distances The ... more rapid turnover The kcat ⁄ Km values increase from G1P over PhyK to AppA by a factor of 2200 The conformational changes of AppA upon substrate binding facilitate a faster turnover of phytate ... Approximately 70% of the model was built automatically After extending the Mse data to a resolution of ˚ 2.04 A, resolve built 76% of the protein model automatically The Mse–PhyK structure was...
- 13
- 766
- 0
GUIDELINES TO THE CONSTRUCTION OF A SOCIAL ACCOUNTING MATRIX ppt
... accounts totals Finally, a SAM always has a matrix format 72 because of its emphasis on the identification of source and use of all transactions Summarizing, a SAM in our view serves as an alternative ... raw data from the surveys, data already available (e.g the 1-0 table) are scrutinized (e.g the treatment of the interest margin of banks), and data which are lacking are estimated provisionally, ... another, depending on the availability and quality of data and on the wishes of policy makers with respect to classifications and other characteristics Nevertheless, the sequence of tasks tends to follow...
- 30
- 520
- 0
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx
... stalled at R-factors of 26 and 30% This may be due to real disorder in the crystal as the mean B-factor from the refinement was rather high ˚ ˚ (78.5 A2 ) – as was the Wilson B-factor (77 A2 ) It should ... Fcalc|)/( |Fobs|), where Fobs and Fcalc are observed and calculated structure factor amplitudes, respectively Rfree is an R-factor for an unrefined subset of the data (5% of the data) a the metal ... an artifact, it is apparently strong enough to appear in the crystal and adjust the enzyme in an induced-fit-like manner: the conformation of the flap domain changes, M3 metal is introduced and Arg13...
- 10
- 542
- 0
Ten Ways to Improve the Security of a New Computer doc
... daily, and vendors frequently make new signatures available, so antivirus software will be most effective if the signatures are up to date Many antivirus and antispyware programs offer automatic ... updating Enable that feature so your software always has the most current signatures If automatic updates aren’t offered, be sure to install the software from a reputable source, like the vendor’s ... sure to research these features before disabling or modifying them The AutoRun feature in Microsoft Windows systems was a default feature at the time of the Conficker malware and was one of the...
- 5
- 620
- 0
Ocean Acidification: A National Strategy to Meet the Challenges of a Changing Ocean docx
... existing data management offices and databases that could support ocean acidification observational and research data The FOARAM Act also calls for an “Ocean Acidification Information Exchange” that ... surface waters has already been observed in the Canada Basin of the Arctic Ocean (Bates et al., 2009; Yamamoto-Kawai et al., 2009) Persistent undersaturation of surface waters with respect to aragonite ... dedicated to the furtherance of science and technology and to their use for the general welfare Upon the authority of the charter granted to it by the Congress in 1863, the Academy has a mandate...
- 163
- 400
- 0
Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf
... (Iwatani, Fukuoka, Japan) All other chemicals used were of analytical grade Formation of a- hydroxyhaem-rHO-1 complex Scheme The resonance structure of a- hydroxyhaem Unless otherwise stated, the ... out as follows; a portion of the rHO-1 solution was transferred to a custom-made anaerobic titrator [24], that contained % mL of the buffer Then a- hydroxyhaemin dissolved in a small amount of ... disappeared, indicates the formation and degradation of a trace amount of the CO-ferrous verdohaem produced from the free a- hydroxyhaem Acidification and extraction of the product into chloroform gave biliverdin,...
- 9
- 501
- 0
The preference of a Female Greek island population in regard to the gender of their gynecologist pdf
... reported that they preferred a female doctor to take their Pap smear, 48% that they preferred a woman for their breast exam and 36% that they preferred a woman to take a sample of vaginal fluid ... presence of the female researchers, to whom the participants could ask explanatory questions The questionnaire was created The preference of a Female Greek island population in regard to the gender of ... and contingency tables were formed on the questioned variables The x2 test was used on the qualitative variables and the t-test on the quantitative variables From the total of the examined variables,...
- 9
- 432
- 0
Beethoven The story of a little boy who was forced to practice ppt
... public A story is told that once he was to play his C major Concerto at a concert When he arrived at the hall he found the piano was tuned so low that he had to play the Concerto in C# major You ... expense to the user, provide a copy, a means of exporting a copy, or a means of obtaining a copy upon request, of the work in its original "Plain Vanilla ASCII" or other form Any alternate format ... of certain implied warranties or the exclusion or limitation of certain types of damages If any disclaimer or limitation set forth in this agreement violates the law of the state applicable to...
- 14
- 770
- 0
Báo cáo khoa học: Identification of the epitope of a monoclonal antibody that disrupts binding of human transferrin to the human transferrin receptor pptx
... AAAGAATTCATTAAGGTCTACGGAAAGTGCAGG b AAAGGATCCATGAAGTGGTGTGCGCTGAG AAAGAATTCTTACAGGTGAGGTCAGAAGCTGATT AAAGGATCCAATTTTGCTGTAGCAGTGGTGAA AAAGAATTCTTAACCTGAAAGCGCCTGTGTAG AAAGGATCCCCCAACAACAAAGAGGGATACT ... AAAGAATTCTTACTTGCCCGCTATGTAGACAAA c AAAGAATTCTTAATCCTCACAATTATCGCTCTTATT c AAAGAATTCTTACCCTACACTGTTAACACT c AAAGAATTCTTAAACACTCCACTCATCACA d GTGTATCAGCAGAGAACACCGAAGACTGCATCGCC GGCGATGCAGTCTTCGGTGTTCTCTGCTGATACAC ... AAAGGATCCCCCAACAACAAAGAGGGATACT AAAGAATTCTTAGGTGCTGCTGTTGACGTAATAT AAAGGATCCAAGGAAGCTTGCGTCCACAAGATA AAAGAATTCTTAGGCAGCCCTACCTCTGAGATTTT c AAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC c AAAGAATTCTTAATGCAGTCTTCGGTGGTCTCT c AAAGAATTCTTACTTGCCCGCTATGTAGACAAA...
- 10
- 308
- 0
Báo cáo khoa học: "From RAGS to RICHES: exploiting the potential of a flexible generation architecture" pot
... representation language An O /A database consists of a collection of objects, each of which has a unique identifier and a type, and arrows, each of which has a unique identifier, a type, and source and ... the same ideals In addition, we aim to test the claims that the RAGS data model approach supports the flexible processing of information in an NLG setting The RAGS data model The starting ... DocLeafs) and DocLeafs The active database server supports multiple independent O /A databases Individual modules of an application publish and retrieve objects and arrows on databases, incrementally...
- 8
- 368
- 0
Báo cáo khoa học: "The adaptation of a machine-learned sentence realization system to French" potx
... each model This allows us to share the majority of code among the individual feature extraction tasks and among languages Typically, we extract the full set of available linguistic features of ... the relative pronoun model, for example, are the syntactic category of the node, of its parent, the syntactic function of the node, the voice of the parent, the arguments of the parent, and the ... "Unacceptable", "Possibly acceptable", "Acceptable" and "Ideal" The score of a sentence is the average of the scores from the five raters The system score is the average of the scores of all...
- 8
- 295
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25