ocajp 7 certification is a prerequisite for ocpjp 7 certification via the 1z0 804 exam does that mean that i have t
Oracle Certified Professional Java SE 7 Programmer Exams 1Z0-804 and 1Z0-805 docx
Ngày tải lên :
17/03/2014, 19:20
... FAQ FAQ OCAJP certification is a prerequisite for OCPJP certification via the 1Z0- 804 exam Does that mean that I have to take the OCAJP exam before I can take the OCPJP exam? No, requirements ... satisfied the applicable prerequisites for certification (e.g., OCAJP certification as the prerequisite of OCPJP certification via the 1Z0- 804 exam) , a printable certificate can be downloaded from Oracle’s ... program prints Starting to wait Caught InterruptedException c) The program prints Starting to wait Caught Exception d) The program prints Starting to wait After that, the program gets into an infinite...
- 644
- 1.6K
- 5
Báo cáo toán học: "Dissimilarity vectors of trees are contained in the tropical Grassmannian" potx
Ngày tải lên :
08/08/2014, 01:20
... total weight of a tree, we mean the sum of the weights of all the edges in that tree Definition 2.6 The vector D(m, T ) is called the m-dissimilarity vector of T The set of all m-dissimilarity ... phylogenetic tree and then define an ultrametric associated with its 2-dissimilarity vector, therefore inducing an ultrametric tree Here, T corresponds to certain subtrees of this induced ultrametric tree ... w(e) associated to it, called the weight of e • it is d-equidistant, for some d > 0, i. e the sum of the edges in the path from the root to every leaf is precisely d • the sum of the weights of all...
- 7
- 330
- 0
Đề tài:what qualities and skill are needs for the manage people in a company? what is the importance of good human resources?
Ngày tải lên :
26/12/2014, 08:36
... basis of identification and recognition of the values and needs of the communication object This is the basis of the importance of communication, handling conflict and negotiation 4)Communications ... 7) Information processing and thinking capacity • The power of your brain is incalculably large The manager have an enormous potential for creativity, innovation and invention They knowing how to control ... communication • • This skill requires the sophistication, flexibility and social knowledge and experience of managers The objective of this skill is to enhance mutual understanding and respect on the...
- 16
- 1.4K
- 1
Đề tài " Axiom A maps are dense in the space of unimodal maps in the Ck topology " doc
Ngày tải lên :
05/03/2014, 23:20
... converge to some periodic attractor If this attractor is hyperbolic, we are done because then there are no neutral periodic orbits and the map is an Axiom A map The other case is that the attractor is ... variety This lemma remains true if instead of assuming that the map fλ0 is infinitely renormalizable, we assume that the ω-limit set of the critical point of this map is minimal Note that we not assume ... that a dynamical system is structurally stable if and only if it satisfies Axiom A and the transversality condition In this paper we prove this conjecture in the simplest nontrivial case, in the...
- 44
- 412
- 0
BRANDS ARE BUILT IN THE CONSCIOUSNESS OF THE RECEIVER, NOT BY THE COMPANY potx
Ngày tải lên :
09/03/2014, 00:20
... road tankers It was a situation that brought home to many the idea that climate change, whether natural or man-made, was a real threat to human existence The rain that swamped the northern half ... customers.” A typical pitfall, according to Jacob Fant at Rewir, is copying strategies that work for others without thinking them through “Instead, it’s a matter of fi nding what distinguishes them ... and has maintained its hold at the top Together with the Japanese giant Toyota, the world’s largest automaker, these outsiders have broken the otherwise solid US dominance in all categories is...
- 36
- 485
- 0
Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf
Ngày tải lên :
22/03/2014, 21:20
... 2.1up, AAACATATGCTATATTACAATAAAA GG; 2.2up, AAACATATGTTATCTATCGTTGTAAAGC; 2.3up, AAACATATGCTTGTTCCTCAAAAACTTCC; 3.3rv, AAACTCGAGGACCTTAGCCGTAGTCTTCAC; 3.2rv, AAACTCGAGTTTTCCATTCAAAACCGTG Construction ... that SSIIIHD may have different roles in protein–protein interaction and polysaccharide binding Analysis of the starch-binding capacity of the individual SBDs has indicated that D2 has the highest ... highest binding affinity relative to D1 or D3 It is important to note that previous bioinformatics analysis has revealed that the D2 domain has a high structural similarity to the SBD of GA-1 from Aspergillus...
- 13
- 457
- 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
Ngày tải lên :
30/03/2014, 04:20
... CCCTTTGCTGTTGGAT (IV) TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG ... variants (Pfu Ultra system; Stratagene) Upper primer 5¢-CACCGCCG CCACCATGGGATTGTCACGCAAATCATCAGATGC ATCT-3¢ and lower primer 5¢-TTAAAATTCACCA AATTCTTTTGCACATT-3¢ yielded Cb3ab and Cb3abD4, distinguished ... modifications, RNA editing, alternative polyadenylation and multiple start sites of transcription contribute to generating diversity, but alternative splicing is the major mechanism by which this is achieved...
- 13
- 344
- 0
What qualities and skills are needed for the managers to manage people? • What is the importance of good human resources management
Ngày tải lên :
08/07/2014, 10:33
... company, human capital is guaranteed, saving time and recruitment costs 1 Recruitment and training Staff training is an integral part of the overall development strategy of the business Staff ... are not trained or not trained fit is the main cause leading to the current state enterprises are not competitive enough in the market 2 Conflict resolution Resolving conflicts is an important ... groups to achieve all the goals for that group and thus improve the overall quality of workplace experience for all employees Motivation Motivation is an important tool that is often under-utilized...
- 33
- 3.9K
- 10
Báo cáo toán học: "Zeros of the Jones polynomial are dense in the complex plane" pdf
Ngày tải lên :
08/08/2014, 12:22
... was partially finished during Xian’an Jin’s visit at the National Institute of Education, Singapore, supported by NIE AcRf Funding (R1 5/06 DFM) Xian’an Jin and Fuji Zhang are also partially supported ... by a connected signed graph Ha with two attached vertices u and w that has only the vertices u and w in common with G − a ˆ Now we shall establish a relation between the Tutte polynomial of G and ... Eq (29) has a zero t = z + t0 satisfying |t − t0 | < ǫ For the special case that t0 = 0, by the above result, there exists s0 such that for any s s0 , Eq (29) has a zero t satisfying |t − ǫ/2|...
- 10
- 302
- 0
Báo cáo y học: " MRI bone oedema scores are higher in the arthritis mutilans form of psoriatic arthritis and correlate with high radiographic scores for joint damage" ppt
Ngày tải lên :
09/08/2014, 01:22
... citation purposes) Arthritis Research & Therapy Vol 11 No Tan et al Figure A patient with arthritis mutilans with digital shortening patient with arthritis mutilans with digital shortening (a) ... patient recruitment and participated in data analysis QR was a reader for the X-rays and assisted in manuscript preparation ER provided statistical advice and assisted in data analysis and manuscript ... manuscript preparation WJT assisted in patient recruitment and manuscript preparation PBJ participated in the design of the study and assisted in patient recruitment KP assisted in patient recruitment...
- 9
- 521
- 0
Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt
Ngày tải lên :
09/08/2014, 10:22
... studies have demonstrated that, after repeated oral administration of type II collagen (CII) and subsequent induction of CIA, the mean arthritis index is lower in tolerized mice than in CIA mice [12] ... determining immunity or immune tolerance; this determination is based on the maturation or activation state and the subset of DCs, and cytokine profiles in the microenvironment at the time of antigen ... Statistical analysis The arthritis scores at the different times were compared between the two groups using the nonparametric Mann–Whitney U test All data are expressed as the mean ± standard deviation...
- 10
- 473
- 0
Báo cáo y học: "Reduced proportions of natural killer T cells are present in the relatives of lupus patients and are associated with autoimmunity" ppt
Ngày tải lên :
09/08/2014, 13:21
... The Arthritis Society/CIHR Investigator Award Dr Fortin is funded by an Investigator Award from The Arthritis Society/CIHR Institute of Musculoskeletal Health and Arthritis and by The Arthritis ... studies, and data acquisition SL, NR, CMTG, and ADP performed the statistical analyses TM and JOC coordinated the acquisition of laboratory samples, clinical data acquisition, and entry of clinical and ... genetically related individuals within the same family, suggests that the reduced proportion of NKT cells is a heritable trait These findings raise the possibility that one of the explanations for...
- 13
- 451
- 0
Báo cáo y học: "MRI bone oedema scores are higher in the arthritis mutilans form of psoriatic arthritis and correlate with high radiographic scores for joint damage" ppsx
Ngày tải lên :
09/08/2014, 13:22
... citation purposes) Arthritis Research & Therapy Vol 11 No Tan et al Figure A patient with arthritis mutilans with digital shortening patient with arthritis mutilans with digital shortening (a) ... patient recruitment and participated in data analysis QR was a reader for the X-rays and assisted in manuscript preparation ER provided statistical advice and assisted in data analysis and manuscript ... manuscript preparation WJT assisted in patient recruitment and manuscript preparation PBJ participated in the design of the study and assisted in patient recruitment KP assisted in patient recruitment...
- 9
- 509
- 0
Báo cáo y học: "B-lymphocyte stimulator/a proliferation-inducing ligand heterotrimers are elevated in the sera of patients with autoimmune disease and are neutralized by atacicept and B-cell maturation antigen-immunoglobulin" pdf
Ngày tải lên :
12/08/2014, 12:20
... levels and their apparent relation with disease activity is warranted in a large cohort of patients with autoimmune diseases Mechanistic studies to determine if BLyS/APRIL heterotrimers play a biologic ... alter the biologic activity of these ligands in this assay Atacicept and BCMA-Ig neutralized the activity of BLyS, APRIL, and heterotrimers in the TACI-Jurkat assay (Figure 3b) As expected, BAFF-R-Ig ... Biologic activity and neutralization of heterotrimers Heterotrimer signaling was similar to that of APRIL in the in vitro TACI-Jurkat assay (Figure 3a) Trypsinized versions of the heterotrimers and...
- 14
- 460
- 0
Báo cáo y học: "Pro/con clinical debate: Antibiotics are important in the management of patients with pancreatitis with evidence of pancreatic necrosis" ppt
Ngày tải lên :
12/08/2014, 19:22
... treatment of patients with severe pancreatitis, even in the setting of pancreatic necrosis The few prospective studies that exist investigating antibiotic use in severe pancreatitis have been nonblinded ... prophylactic antibiotics in the setting of severe pancreatitis, there is some evidence suggesting that misuse of antibiotics leads to devastating superinfections Isenmann and Available online http://ccforum.com/content /7/ 5/351 ... Other large trials utilizing gastrointestinal decontamination in groups of critically ill patients have failed to demonstrate a decrease in mortality or intensive care days This extensive protocol,...
- 3
- 303
- 0
Báo cáo y học: " Detection of a gammaretrovirus, XMRV, in the human population: Open questions and implications for xenotransplantation" ppsx
Ngày tải lên :
12/08/2014, 23:23
... HIV-1 diagnostic tests Is it possible that the antibody response detected was against a related retrovirus such as XMRV? If XMRV is indeed circulating in the human population, it has important ... CSF is characterized by debilitating fatigue, chronic inflammation and other abnormalities of the immune system such as a deficiency in natural killer cell activity In 68 of 101 CFS patients ( 67% ), ... xenotransplantation of porcine tissues and organs to humans Xenotransplantation is a potential solution for the shortage of allogeneic human organs Designated pathogen-free breeding and maintenance...
- 3
- 290
- 0
Báo cáo y học: "The cardiac force-frequency relationship and frequency-dependent acceleration of relaxation are impaired in lipopolysaccharide-treated rats: is the" potx
Ngày tải lên :
13/08/2014, 16:20
... membrane-bound modulatory protein [7] The rapidity at which calcium is returned to the sarcoplasmic reticulum is directly related to the rapidity of cardiac relaxation In the unphosphorylated state, ... septic patients being treated in the intensive care unit [9] It is well known that the mediators of the sepsis syndrome are numerous Anesthetic agents were used to regulate heart rates, and real-time ... real-time alterations in physiological functioning may have been missed The group studied only the sarcoplasmic reticulum when calcium trafficking is also linked to mitochondrial function and integrity,...
- 2
- 220
- 0
Báo cáo y học: "Systems biology-defined NF-κB regulons, interacting signal pathways and networks are implicated in the malignant phenotype of head and neck cancer cell lines differing in p53 status" pps
Ngày tải lên :
14/08/2014, 08:20
... 5'biotin-ACTGAGCCTTCCTCACATCCTCCTTCTTCAGGCTTGGGCTTTCCACCTTT-3' for the RELA binding site, 5'-biotinAGGTGAATTCCTCTGAAAGCTGACTGCCCCTATTTGGGACTCCCCAGTCT-3 for the NFκB1 binding site; ITGA5, 3'-biotin-CTCCGCCCACCAGAGGTGATTCCTTTCCTCATTAGGAAATTCTCCGCTCC-5' ... GGGGAATCCCAGTTGG-5' for the NFκB1 binding site; LAMB3, 3'-biotin-ACTTGTGGTCAGGTCTGTTTTCTGGCCCTCCAGG CGGGCATTCCTGCCTA-5' for the RELA binding site, 3'-biotin-GGTGAGGCTGTTGTTTAAAAACCTGGAGCCGGGAGGGGAGACCCCCACAT-5' ... motif flanked with the natural sequences of promoters of: IL8, 5'-biotinCCCTGAGGGGATGGGCCATCAGTTGCAAATCGTGGAATTTCCTCTGACAT-3' for the RELA binding site; CDKN 1A, 5'biotin-ACTGAGCCTTCCTCACATCCTCCTTCTTCAGGCTTGGGCTTTCCACCTTT-3'...
- 22
- 434
- 0
An investigation into how visual aids are used in the process of teaching english to10th grade classes at krongbuk high school
Ngày tải lên :
23/04/2015, 23:05
... two: Reviews the literature related to the study Firstly, it gives a brief introduction of visual aids Secondly, it states the advantages of using visual aids in language teaching Thirdly, it ... the visual aids Teachers need to prepare pens, papers, film, ect to support learners in case they not have Visiting the class in advance is another thing that the teachers must (Kaye Vivian_http:// ... quite a lot of mohandouts or to find information, illustrative pictures from the Internet to support their students So that the teachers hoped that there should be materials available to make...
- 49
- 687
- 1
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
Ngày tải lên :
12/09/2012, 15:05
... passes it to a default pager task, that is known to the kernel at system initialization time5, in a pager_create call This call is similar in form to pager_init; however, it cannot be made on the ... the default pager In this way, the kernel is protected from starvation by errant data managers Because the interface to the default pager is identical to other external data managers, there are ... first uses a page of the data, it generates a page fault To fill that fault, the kernel issues a pager_data_request for that page To fulfill this request, the data manager responds with a pager_data_provided...
- 23
- 1.3K
- 1