obligation and provided that the value can be measured reliably recognition of a liability entails simultaneous recognition of an asset the decrease in another liability or recognition of an expense or other reductions in equity
ELA, Promissory Notes and All That: The Fiscal Costs of Anglo Irish Bank pdf
... The word “funded” can have an elastic meaning. However, this answer suggests an interpretation in which the appearance of an ELA asset on the Central Bank of Ireland’s balance sheet is accompanied by an increase in Intra‐Eurosystem liabilities. It is my understanding that this is not the case. At the ... meeting. Haircuts are applied to the collateral so that the amount that is loaned to the borrowing bank is less than the value of the asset, 8 with the amount that can be loaned ... counterparties to pledge particular types of collateral in return for borrowing money and Anglo began to run out of eligible collateral as the Irish banking crisis began in late 2008. In March 2009, the Central Bank of Ireland agreed a “Master Loan Repurchase Agreement” with ...
- 28
- 322
- 0
Báo cáo y học: "Clinical relevance of and risk factors for HSV-related tracheobronchitis or pneumonia: results of an outbreak investigation" doc
... participated in the collection, interpretation and analysis of clinical data AM participated in the collection, interpretation and analysis of clinical data DS performed the statistical analysis AR participated ... drafting of the manuscript TW participated in the interpretation of data and drafting of the manuscript TFS participated in the study design, interpretation of the data and drafting of the manuscript ... manuscript FM initiated the study, participated in the design of the study and in the interpretation and analysis of clinical data, and contributed to the writing of the manuscript Available online http://ccforum.com/content/11/6/R119...
- 11
- 363
- 0
The Research Tax Credit’s Design and Administration Can Be Improved potx
... before it can begin earning any credit) perfectly measures the amount of spending that the taxpayer would have done anyway This credit maintains an incentive for marginal spending but eliminates ... certain Many of the tax practitioners we interviewed had a common general complaint that IRS examiners often demanded that the research activities result in a higher standard of innovation than ... returns, including long-standing uncertainties and changes in the research tax credit regulations The practitioners say that IRS’s standards are stricter than Congress intended and what has been allowed...
- 119
- 1,692
- 0
How can children be obese and hungry at the same time? pot
... license plates and food labels; and think of other words that begin with each letter Or maybe you’re reading a book about animals – try visiting a farm or a zoo; sing animal songs; make animal noises; ... nutrition awareness into the classroom, the children will have the opportunity to plant and watch a garden grow as they and their parents work together to bring a message that a meal can be good and ... This data, collected from the CDC Behavioral Risk Factor Surveillance System, also showed that African-Americans and Hispanics respectively had a 51% and 21% prevalence of obesity when compared...
- 16
- 440
- 0
financial report 1999 holderbank the financial results posted in 1999 demonstrate that the group has further consolidated its position and created real added value
... selling price and value in use The net selling price is the Gains from a sale are included in the liability, and the fi- amount obtainable from the sale of an asset in an arm’s nancing costs are ... plant and equipment and intangible assets are are tantamount to the purchase of assets (finance leases) reviewed for impairment whenever events or changes in are shown as assets and reported at ... projects at Garadagh Cement J.S.C (Azerbaijan), Huaxin Cement Holnam Inc (USA) and Juan Minetti S .A (Argentina) Company Ltd (China) and Siam City Cement (Public) Company Limited (Thailand), and the increase...
- 74
- 314
- 0
Báo cáo y học: "How the relationships between general practitioners and intensivists can be improved: the general practitioners'''' point of view" ppt
... patient's ICU stay (more than one meeting for 47%) A lack of information (36%) and the poor quality of information (85%) were the two major reasons for the patient's family to meet the GP GP and ... design (BE, SJ, PM, XC, PFP, JYL) or acquisition of data, or analysis and interpretation of data (BE, TM, FM, PFP, JYL) and/ or have been involved in drafting the manuscript or revising it critically ... admission, the primary diagnosis, and the treatment The impact of systematic and complete conveyance of information to the patient's GP remains to be studied Improving the quality of information flow...
- 9
- 362
- 0
Báo cáo y học: " The electronic version of this article is the complete one and can be found onlin" pot
... each other Clifford: Now I’m the one who’s not understanding Mink: What I mean is that Greg is always complaining that chemists can t understand one another because the physical chemists speak ... important area of biology and end with a list of some of the major outstanding problems in that area and what sort of things would help get them solved That way, people from other disciplines ... chemists and physicists and hardly any chemists and physicists know what to make of the typical biology seminar, with its lists of gene names and gel slides and acronyms that don’t stand for anything...
- 2
- 190
- 0
Báo cáo y học: "The electronic version of this article is the complete one and can be found online" potx
... Drosophila Dally and Dally-like protein are encoded on the same chromosome, but are far more distantly linked than are the mammalian clusters Glypican proteins are between 555 and 580 amino acids in ... inhibiting the receptor phosphatase LAR [23] In addition, it has been proposed that glypicans can be involved in the uptake of polyamines [24] Glypicans can also be shed into the extracellular environment ... particles are critical for the long-range activity of Wnts and Hhs [6,33] In the particular case of Hh, it has been proposed that the glypicans in lipophorins may promote the formation of ligand-receptor...
- 6
- 390
- 0
Báo cáo y học: "The electronic version of this article is the complete one and can be found online at" pps
... DD|395578 DV|206272 CTGTTGACAGTGTAAGGTGAGCTTTGTTAAATATCTCACAAGCGCA-CGGGCCAACGAACTCGTAAAAGTCTCCGTTAGGCA CGCTTGACACATCAGGGGTGACATTGTTAATTCCATCACAAGCGCAGCGGGCTCCCCA -CAACGAAGTGTT G * ****** * ** ... desulfuricans 392869 209119 Hypothetical protein conserved in Archaea TTGTtAAATAaTTCACAA -118 395578 apsAB APS reductase TTGTtAAATATcTCACAA -186 5.77 394579 sat ATP sulfurylase TTGctAAAaATTTCACAA -147 ... DD|395578 DV|206272 GGCCAAACAGGTTAAACCCTTAATTCCGTTTGTGTTGGAGGAATAGGTATGCCGACTTATGTTGATCCGTCCAAGTGTGATG -GCCAAGCA -AACCCTTAATTCTGTTTGAGTTGGAGGATAAGGTATGCCGACTTATGTTGATCCGTCCAAGTGCGACG ***** ** ************...
- 27
- 356
- 0
Strategic environmental assessments may be used to compare different energy scenarios, and a more sustainable power plan can be developed by incorporating the wider impacts considered during the assessment process
... concentrated in central and northeast Thailand and along Viet Nam’s coastline; (ii) biomass potential is concentrated in the major rice-growing areas of the Chao Phraya basin, northeast Thailand, and ... Some indicators are obviously more important than others and these can be emphasized in the radar diagrams through a weighting process The values that can be ascribed to indicators that are most ... Chuenchom Sangarasri Greacen (Palang Thai); Ame Trandem (International Rivers); and Witoon Permpongsacharoen (Mekong Energy and Ecology Network) Finally, the support of Carl Bernadac and Olivier Grandvoinet...
- 50
- 456
- 0
Procedural Abstraction and Functions That Return a Value
... formal parameters Formal parameter names may or may not match variable names used in the main part of the program It does not matter if formal parameter names match other variable names in ... call-by -value parameter mechanism? Write a function declaration and a function definition for a function that takes one argument of type int and one argument of type double, and that returns a value ... division: int total_candy = 9, number _of_ people = 4; double candy_per_person; candy_per_person = total_candy / number _of_ people; candy_per_person = 2, not 2.25! A Type Cast produces a value of one type...
- 94
- 541
- 0
EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE
... accordance with the law of supply and demand, there will be a new equilibrium point, and an increase in quantity demanded that will be met by exporters Therefore, an increase in quantity demanded ... adjustment can be made: physical characteristics, import charges and indirect taxes, discounts, rebates and quantities, level of trade, transport, insurance, handling, loading, and ancillary costs, packing, ... to the study In recent years, a great number of bilateral and multilateral trade agreements have been signed between Vietnam and other countries and international organizations, which, among other...
- 66
- 538
- 4
EU ANTI-DUMPING LAWSUIT AGAINST VIETNAM - WHAT CAN BE LEARNT FROM THE FOOTWEAR CASE?
... at the Azerbaijan, Georgia, date of the initiation of the investigation Kyrgyzstan, Moldova and Mongolia Other non-market economies Belarus, Korea, Turkmenistan, North Tajikistan, and Uzbekistan ... presentation of financial statements' that 'the objective of financial statement is to provide information about the financial position, performance and changes in financial position of an entity that is ... concentrated in Italy, Portugal, and Spain In the table below are presented certain indicators provided by Italy, Spain, Portugal, France, Poland and Greece which demonstrate that the sector has been...
- 84
- 544
- 0
Words and expressions that frequently appear on the TOEIC
... being in pain prior to(= before) suffering a heart attack and collapsing regardless of The plan for a new office tower went ahead regardless of local opposition thanks to Thanks to yesterday's rain, ... use more machinery now throughout the day He worked hard throughout the day trial and error We can learn through trial and error turn in( = submit, hand in) The general manager turned in the finished ... to The kitchen roof is apt to leak when it rains be ashamed of Oliver Twist was not ashamed of asking for more food be available to It is vital that food is made available to the famine areas be...
- 18
- 933
- 0
Tài liệu Write Data Validation Code That Can Be Reused in Other Classes docx
... known as an abstract class, and it is best described as a hybrid between an interface and a class(see Table 9.3) Like an interface, instances of an abstract class cannot be created directly, and ... Get Set(ByVal Value As String) Dim fCancelChange As Boolean If isValid (Value) Then RaiseEvent StringValueBeforeUpdate (Value, fCancelChange) If Not fCancelChange Then mstrValue = Value End If ... NotInheritable The class is in a finalized state and cannot be used as a base class 13 Declare the two class-level variables: cValidChars and mstrValue Note that both variables are declared as...
- 16
- 360
- 0
Why do Internet services fail, and what can be done about it? ppt
... operator failure to system outages They found that planned maintenance and software installation and configuration caused the largest number of outages, and that system software and planned maintenance ... including configuration and system state before and after each change, who or what made the change, why they made the change, and exactly what changes they made would help operators understand ... backup machine after the primary had failed really an operator error, if the operator was unaware that the primary had failed? Was intentionally leaving the tape backup broken an operator error?...
- 15
- 387
- 0
Báo cáo khoa học: The propagation of hamster-adapted scrapie PrPSc can be enhanced by reduced pyridine nucleotide in vitro pdf
... processes of experiments, including 1542 anaesthetic and surgical procedures, as well as animal management, have been reviewed and approved, and were performed in accordance with the relevant China national ... PrPSc maintains a stable propagating capacity in normal brain homogenates after NADPH is removed Because the increased level of NADPH-diaphorase may correlate with the active synthesis of NADPH, ... contamination, all materials and reagents were freshly prepared, including the homogenizer, chemicals and conversion buffer NBH and ScBH (SHa-13 9A) were prepared in another laboratory that had never been...
- 10
- 342
- 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... where A and B are the MICs of drug A and drug B in the combination, MICA and MICB are the MICs of drug A and drug B alone, FICA and FICB are the FICs of drug A and drug B and n is the number of ... synergy or antagonism between antifungal agents tested against Candida species J Antimicrob Chemother 49, 345–351 59 Makovitzki A, Avrahami D & Shai Y (2006) Ultrashort antibacterial and antifungal ... thank M Simmaco for use of the facilities and platforms available in the DiMA Unit of the Sant’Andrea Hospital This work was funded in part by Italian ` Ministero dell’Universita e Ricerca (PRIN...
- 18
- 494
- 0
Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt
... sorting signals, transmembrane sorting signals have been identied For example, the gastric H,K-ATPase has an apical sorting signal in its 4th transmembrane domain, although the exact amino acids responsible ... from the American Brain Tumor Association Michael Reiss Fellowship (A. L.), Art of the Brain (A. L.), unrestricted funds from the Cancer Center of Santa Barbara (A. L.), and National Institutes of ... mutant Cx43eYFP construct may indicate the presence of another basolateral sorting determinant located in the second transmembrane domain of Cx43 Although not as common as cytoplasmic sorting...
- 14
- 433
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008