0

nsaid cox 2 cyclooxygenase 2 inhibitor the first choice should be either a standard nsaid or a cox 2 inhibitor in either case for people over 45 these should be co prescribed with a ppi proton pump inhibitor

A study on the bennefits of using portfolios as a means of assessment in the writing development for the third year stdents of english at hanoi pedagogical university no 2

A study on the bennefits of using portfolios as a means of assessment in the writing development for the third year stdents of english at hanoi pedagogical university no 2

Anh văn thương mại

... can be kept informed of next plans for teaching and learning and the progress being made, so they can play an active role in their children’s learning School leaders can use the information for ... the pivotal arguments in favor of developing and extending the practice of formative assessment in writing classes is put forth by Hawkey and Barker , 20 04 In supporting the practice of formative ... teachers and students with the latter greatly emphasized Benefits for teachers According to Grabe and Kaplan, portfolios serve as assessment tools for teachers both in large-scale and in- class...
  • 65
  • 893
  • 7
báo cáo khoa học:

báo cáo khoa học: "Acute abdomen due to spontaneous splenic rupture as the first presentation of lung malignancy: a case report" ppsx

Báo cáo khoa học

... Pneumococcal and meningococcal vaccines were administered and our patient was then promptly taken to theater for laparotomy On examination of her internal organs at laparotomy, other than hemorrhage ... mmHg, heart rate of 72 beats per minute, saturations 97% on a nonrebreather mask and temperature of 36.9°C The admission examination revealed normal cardiac examination and bibasal inspiratory crepitations ... represented metastases rather than wedge fracture, but there were no abnormalities or neoplastic disease affecting the intra-abdominal organs Figure Large left anterior mediastinal mass with prominent...
  • 4
  • 347
  • 0
báo cáo khoa học:

báo cáo khoa học: " The first three-dimensional visualization of a thrombus in transit trapped between the leads of a permanent dual-chamber pacemaker: a case report" docx

Báo cáo khoa học

... thrombus Overlapping with the heparin therapy, we initiated oral anticoagulant therapy and continued with an International Normalized Ratio (INR) 2. 0 - 3.0 He had an uneventful recovery and follow-up ... reconstruction AM and HT have been involved in drafting the manuscript and revising it critically for important intellectual content All authors read and approved the final manuscript Competing ... Bad Krozingen, Südring 15, 79189 Bad Krozingen, Germany Authors’ contributions PM analyzed and interpreted patient data regarding the cardiac disease and was a major contributor in writing the...
  • 4
  • 290
  • 0
The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning

The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning

Môi trường

... Legionnaire’s disease The bacteriological contamination, mainly by legionnaire’s bacteria, has become the main disadvantage of the evaporative cooling systems Therefore, this implies that in many cases ... the primary air stream and transfer it to the secondary air in the evaporative cooling process They can be made either of metal or plastic and must easily conduct heat, maintain the two streams ... systems 4 .2 Indirect evaporative cooling systems In the case of indirect evaporative cooling, water evaporates in a secondary air stream which exchanges sensible heat with the primary one in a heat...
  • 28
  • 652
  • 0
Symptomatology of Gynecological Malignancies: Experiences in the Gynecology Out-Patient Clinic of a Tertiary Care Hospital in Kolkata, India pot

Symptomatology of Gynecological Malignancies: Experiences in the Gynecology Out-Patient Clinic of a Tertiary Care Hospital in Kolkata, India pot

Sức khỏe phụ nữ

... carcinoma of the vulva (5%), choriocarcinoma (4.7%) and carcinoma of the vagina (1 .2% ) Chhabra et al (20 02) observed in a study conducted in a rural institute in India, that cervical cancer was the ... According to the previous records (20 022 003, 20 03 -20 04 and 20 04 -20 05), the total number of gynecological malignancy patients reported annually on Friday and Saturday was on an average 21 5, among the ... symptom among ovarian cancer patients as found by Chhabra et al (20 02) was pain in abdomen ( 62. 8%) According to Odukogbe et al (20 04), abdominal swelling was the most common presenting symptom among...
  • 7
  • 321
  • 0
the game audio tutorial [electronic resource] a practical guide to sound and music for interactive games

the game audio tutorial [electronic resource] a practical guide to sound and music for interactive games

Đại cương

... contained in the material herein Library of Congress Cataloging -in- Publication Data Application submitted British Library Cataloguing -in- Publication Data A catalogue record for this book is available ... General rain Rain on trees Rain on water Rain on metal roof Rain on hollow metal barrels Rain on plants The Game Audio Tutorial You can see from the diagram that these have had to be carefully arranged ... not really the whole story You may have noticed in the past that for a variety of reasons distances in games are not the same as distances in the real world To measure a distance in the viewports,...
  • 446
  • 734
  • 0
planning under pressure the strategic choice approach j friend & a hickling (elsevier 2005)

planning under pressure the strategic choice approach j friend & a hickling (elsevier 2005)

Kiến trúc - Xây dựng

... British Library Cataloguing in Publication Data A catalogue record for this book is available from the British Library Library of Congress Cataloguing in Publication Data A catalogue record for this ... environmental policy, in local, national and – increasingly – international settings These programmes had their roots in his earlier work in facilitating policy-making in the Netherlands in such areas as ... more information, for clearer objectives and for more co- ordination – can be regarded as a different kind of attempt to manage the current state of uncertainty over what should be done about the...
  • 399
  • 202
  • 0
báo cáo hóa học:

báo cáo hóa học:" Assessing the construct validity of the Italian version of the EQ-5D: preliminary results from a cross-sectional study in North Italy" docx

Hóa học - Dầu khí

... support in designing the study and for the data management plan, Dr Dallolio coordinated data entry and data analysis, Dr Savoia provided assistance with data analysis and the narrative of the manuscript ... impairment Angina, asthma and COPD mainly affected the usual activities domain Angina was associated with the anxiety and depression domain with 21 0% increased odds of reporting impairment (OR ... items ranged from 0.34 for the usual activities domain to 0 .25 for the self-care and mobility domains While the PCS- 12 score correlated with the anxiety and depression domain with a coefficient as...
  • 9
  • 421
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Relationships between the intra-ring wood density assessed by X-ray densitometry and optical anatomical measurements in conifers. Consequences for the cell wall apparent density determination" pps

Báo cáo khoa học

... serial correlation into account neither the non stationary character of the measurements all along a ring and with only a limited number of available anatomical characteristics In a different way, ... study intends to compare the evolution of the intra ring density and of anatomical characteristics measured on the transverse plane all along the ring in order to obtain an anato- mical interpretation ... wood increases all along the period of a growth ring as a consequence of anatomical and chemical modifications The mean variation for the six studied rings is Intra-ring density and anatomy in conifers...
  • 12
  • 283
  • 0
báo cáo khoa học:

báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot

Báo cáo khoa học

... responsible for running the project CR was responsible for the statistical analyses All authors interpreted the data and findings CR wrote the first draft of the manuscript, all authors read and approved ... developed and operationalised theories concerned with the determinants of behaviour and behaviour change [2] These standard definitions of constructs and measurement methods may be useful for exploring ... practice and could not accurately be attributed to individual primary care doctors Statistical analysis In all statistical analyses, the three targeted tests are reported and analysed separately...
  • 9
  • 367
  • 0
Báo cáo y học:

Báo cáo y học: " The MATISSE study: a randomised trial of group art therapy for people with schizophrenia" pdf

Báo cáo khoa học

... the participant A ‘proxy GAF’ based on best available information from whatever contact they had had with the participant, key informants and clinicians was made Following the collection of all ... the data was extracted from, rated each extract as coming from either an Art Therapy group or an activity group Measures At baseline, demographic and clinical data were collected including; age, ... of allocation status by an independent administrator The administrator simultaneously informed local art therapists or activity group facilitators of the allocation status of the participant...
  • 9
  • 344
  • 0
Báo cáo y học:

Báo cáo y học: "Clinical importance and impact on the households of oseltamivir-resistant seasonal A/H1N1 influenza virus in healthy children in Italy" ppt

Báo cáo khoa học

... 119-sequence ACATCTGGGTGACAAGA; N2 29 2 -29 4-forward BIOTIN-TTCATTGAGGAGGGGAAAA; N2 29 2 -29 4-reverse GATCAACGCAATGGCTACTG; N2 29 2 -29 4-sequence GCCTATTGG AGCCTT The children’s medical history was re-evaluated ... BIOTIN-CCACGTTTTGATTAAAAGACACC; N1 27 5-sequence AGTTGAATGCACCCAAT; N1 29 4sequence TGTGTGTATGCAGGGAC; N2 119-forward TTTTATCTGACCAACACCACCATAGAG; N2 119reverse BIOTIN-CGCTAAGGGGTCCTATCATGTACT; N2 119-sequence ... (0.05 μM); A/ H3-forward CCTTTTTG TTGAACGCA-GCAA (1 μM); A/ H3-reverse CGGATGAGGCAACTAGTGACCTA (1 μM); A/ H3-probe VICCCTACAGC-AACTGTTACCMG BNFQ (0 .25 μM); B-forward TCACGAAAAATACGGT GGATTAAA (0.75...
  • 4
  • 307
  • 0
Báo cáo y học:

Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt

Báo cáo khoa học

... 3’) Aggrecan Forward: GAGGTCGTGGTGAAAGGTGT Annealing temperature (°C) 60 Reverse: GTGTGGATGGGGTACCTGAC COL 1A1 Forward: AGGGCCAAGACGAAGACATC 62 Reverse: AGATCACGTCATCGCACAACA RNA extraction and ... and then the COL 2A1 Forward: CAACACTGCCAACGTCCAGAT 62 Reverse: CTGCTTCGTCCAGATAGGCAAT MMP-3 Forward: TTTTGGCCATCTCTTCCTTCA 65 Reverse: TGTGGATGCCTCTGGGTATC ADAMTS- Forward: GACCTTCCGTGAAGAGCAGTGT ... CCTGGCAGGTGAGTTTGCAT ADAMTS- Forward: CCTGGCAGGTGAGTTTGCAT 60 Reverse: GGAGAACATATGGTCCCAACGT GAPDH Forward: ACTCTGGCAAAGTGGATG 60 Reverse: TCCTGGAAGATGGTGATG expression of the Link N-treated...
  • 9
  • 402
  • 0
The soneplex e1 quad loop extender (EQLX) module converts four multiplexed, e1 signals into an optical e2 for delivery over two singlemode optical fib

The soneplex e1 quad loop extender (EQLX) module converts four multiplexed, e1 signals into an optical e2 for delivery over two singlemode optical fib

Phần cứng

... reducing operational costs of managing the network Creating a recognizable infrastructure chassis provides a common interface for any technician and a common system for both current and future installations ... fibers already in the raceway, and increases the raceway system’s overall flexibility As more installations go beyond the recommended 2- inch fiber cable pile up in raceways, the possibility increases ... changing market conditions Managing growth and change in the wireless network isn’t as simple as installing new routers or deploying new radios and media gateways Increasing capacity and features...
  • 8
  • 357
  • 0
An action research on the use of continuous feedback to improve the first year students' pronunciation at the english department, college of foreign languages, vietnam national university, hanoi part 2

An action research on the use of continuous feedback to improve the first year students' pronunciation at the english department, college of foreign languages, vietnam national university, hanoi part 2

Thạc sĩ - Cao học

... so as for the action to take place Without a clear goal in mind, people not know what to work for Another important issue relating to goals is that goals should be attainable, but not easy to achieve ... etc.), and the content of what they have said Therefore, after that, students may forget all about it Then, students have to wait for about four weeks before their turns come again 29 Furthermore, ... three for writing, and four for speaking and pronunciation) The pronunciation lesson is incorporated into speaking lesson and lasts one period, accounting for 45 minutes In each pronunciation...
  • 76
  • 1,069
  • 2
UNIT 2: THE FIRST JOB

UNIT 2: THE FIRST JOB

Tiếng anh

... fo fearsome prospects in their minds Work= UNIT 2: THE FIRST JOB Why those things happen to them? The unsatisfactory nature of the guidance given at home and in the school UNIT 2: THE FIRST ... Teacher UNIT 2: THE FIRST JOB Worker UNIT 2: THE FIRST JOB Nurse UNIT 2: THE FIRST JOB Engineer UNIT 2: THE FIRST JOB Singer UNIT 2: THE FIRST JOB Businessman UNIT 2: THE FIRST JOB IV CONSOLIDATION: ... Children are well-prepared for employment FALSE Only a few boys and girls have given a little great deal of thought to their future work FALSE UNIT 2: THE FIRST JOB B Rearrange these things in order...
  • 29
  • 630
  • 1
2 tests for the first exam

2 tests for the first exam

Tiếng anh

... he entered the National Institute for the blind in Paris One day his class went to visit a special exhibit by a captain in the army One thing in the exhibit was very interesting for Louis It ... carefully and choose the correct answer: Louis Braille was born in France in1 809 His father had a small business He made shoes and other things from leather Louis liked to help his father in the store ... learn C learning D leant He’s always late for class, ………… annoys the teacher .A which B that C what D who 10 We haven’t seen each other ……… we left school A for B before C after D since 11 A...
  • 4
  • 955
  • 2
2 revisions for the first exam

2 revisions for the first exam

Tiếng anh

... and(36) .in a diverse range of technologies (37) the computer and the internet became mainstream in the 1990s,its importance and centrality in communication has become unassailable Therefore,images ... with a complex mix of visual,auditory,oral and interactive media as well as traditional text .People of lesser education or older people may see themselves(44) .behind as the informational gap ... run a long distance During marathon training, adequate recovery time is crucial If fatigue or pain is felt, it is recommended to take a break for a couple of days or more to let the body heal Overtraining...
  • 4
  • 482
  • 0
TEST FOR THE FIRST TERM( BOOK 2)

TEST FOR THE FIRST TERM( BOOK 2)

Tiếng anh

... marks) 1 .A August 2. D.candy 3.C.ruler 4.B Monday II Choose the right words to fill in the blank (2 marks) these 2. are 3.on 4.Music III Select and tick the letter A, B or C(2marks) 1.C 2. B 3 .A ... read and write in Vietnamese V Write the answers (2marks) 1.There are ( forty students in my class.) 2. My favourite subject is ( English.) 3.(I like English because I want to be an English teacher.) ... Reorder the sentences to make a dialogue (2 marks) Hi, Nam How are you? I’m fine, thank you And you? Fine, thanks Do you have Vietnamese today? Yes, I What you during Vietnamese lessons? We learn...
  • 2
  • 1,291
  • 4

Xem thêm