nrf2 mafk is a responsive factor for gpe1 enhancer activity
Báo cáo y học: "Advanced paternal age is a risk factor for schizophrenia in Iranians" pps
... order/rank and schizophrenia may be due to paternal age In fact, as advanced paternal age was a risk factor for schizophrenia, the disease frequency was greater in children with higher birth rank as ... Tsuchiya KJ, Takagai S, Kawai M, Matsumoto H, Nakamura K, Minabe Y, Mori N, Takei N: Advanced paternal age associated with an elevated risk for schizophrenia in offspring in a Japanese population Schizophr ... rare human disease has prompted research on complex common disease to focus on genetic approaches Table Sample classes as a function of parental or maternal age at birth Group Parental age at...
- 6
- 405
- 0
Báo cáo y học: "Aboriginal status is a prognostic factor for mortality among antiretroviral naïve HIV-positive individuals first initiating HAART" ppt
... plasma viral load, age, education, adherence, and history of IDU were associated with HIV plasma viral load response The univariate and multivariate associations of aboriginal status, clinical and ... information on socio-demographic characteristics, there is always a chance for missing information To date several studies dealt with missing information via assumptions about the missing data or ... the HAART era, declines in deaths were smaller among racial minorities (black, Hispanic, Asian/Pacific Islanders, American Indian/Alaskan Native) compared with whites [45] These studies indicate...
- 9
- 498
- 0
Báo cáo y học: "Matrin 3 is a co-factor for HIV-1 Rev in regulating post-transcriptional viral gene expressio" pptx
... nuclear matrix proteins Proc Natl Acad Sci USA 1991, 88:10312-10316 51 Hisada-Ishii S, Ebihara M, Kobayashi N, Kitagawa Y: Bipartite nuclear localization signal of matrin is essential for vertebrate ... 5′GTCTCTCTGGTTAGACCAG-3′, Primer C 5′-CTAGTCAAAATTTTTGGCGTACTC-3′ and primer A and sj4. 7A 5′- TTGGGAGGTGGGTTGCTTTGATAGAG-3 for spliced Kb transcript For GAPDH forward 5′ CTCTGCTCCTCCTGTTCGAC 3′ and GAPDH ... http://www.retrovirology.com/content/8/1/61 reading and commenting on the manuscript, and Barbara Felber for sharing several critical reagents We are grateful to Anna Kula and Alessandro Marcello for sharing data in their paper prior...
- 10
- 313
- 0
Báo cáo y học: "Asthma is a risk factor for acute chest syndrome and cerebral vascular accidents in children with sickle cell disease" ppt
... supported an asthma diagnosis Most patients with asthma are not cared for by asthma specialists and frequently the diagnosis is made on clinical grounds without formal pulmonary function testing Additionally, ... infiltrates or arterial hypoxemia The study excluded children with an exacerbation of reactive airways disease If patients with sickle cell disease are at increased risk of airway inflammation and ... hypoxemia, and a new infiltrate on chest x-ray that required hospitalization and a transfusion of packed red blood cells A cerebral vascular accident diagnosis was based on the new onset of an acute...
- 5
- 288
- 0
Lanosterol is a survival factor for dopaminergic neurons
... Phosphate buffer saline Phosphatidylcholine Parkinson’s Disease PTEN-induced putative kinase Polyunsaturated fatty acids Standard error of mean Substantia Nigras par compacta Substantia nigras par ... plasmalogen has an ether linkage A major fatty acyl brain PE is arachidonic acid (AA, 20:4), with double bond starting at the omega-6 position AA is the precursor to signal molecules such as ... age-related neurodegenerative disorder (Elbaz and Moisan, 2008) The clinical characterization of the disease, started about half a century ago, is extremely accurate Among experienced clinicians,...
- 102
- 399
- 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf
... release of adenine-lacking cobalamins, such as CN-Cbl and damaged cofactor The fact that the relative efficiencies of metal ions for the reactivation are not always correlated with the ATPase activity ... forming a cavity 11 A in height The size of this cavity is comparable with that of adeninelacking cobalamins, and thus allows the damaged 4940 Materials Crystalline AdoCbl was a gift from Eisai ... it can be assumed that the reactivase mediates the exchange of enzyme-bound damaged cofactor for intact AdoCbl with a rate constant (kcat,cbl-release) of 0.14 min)1 This value is about half of...
- 13
- 620
- 0
Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx
... Glycan and glycosaminoglycan binding properties of stromal cell-derived factor (SDF) -1alpha Glycobiology 10, 21– 29 34 Valenzuela-Fernandez A, Palanche T, Amara A, Magerus A, Altmeyer R, Delaunay ... ligand for LESTR ⁄ fusin and prevents infection by T-cell-line-adapted HIV-1 Nature 382, 833–835 1950 N Charnaux et al Pablos JL, Amara A, Bouloc A, Santiago B, Caruz A, Galindo M, Delaunay T, ... imager after autoradiography scanning For each sample, data were expressed as a ratio of p44 ⁄ p42 MAPKs- or SAPK ⁄ JNK-phosphorylated proteins over total proteins, in absorbance units The mean...
- 15
- 423
- 0
Báo cáo khoa học: "Upper abdominal body shape is the risk factor for postoperative pancreatic fistula after splenectomy for advanced gastric cancer: A retrospective study" ppsx
... 19:537-540 Kunisaki C, Shimada H, Ono H, Otsuka Y, Matsuda G, Nomura M, Akiyama H: Predictive factors for pancreatic fistula after pancreaticosplenectomy for advanced gastric cancer in the upper ... thank Dr S Morita MD for excellent statistical advices 18 19 20 21 22 References 10 11 12 13 14 15 16 Kaminishi M, Shimoyama S, Yamaguchi H, Yamada H, Ogawa T, Kawahara M, Joujima Y, Oohara T: ... intraabdominal complication such as anastomotic leakage or POPF In case of having intraabdominal infectious complication, we changed drains under radiographic examination and lavaged the cavity...
- 7
- 385
- 0
Báo cáo khoa học: "Age is not a limiting factor for brachytherapy for carcinoma of the node negative oral tongue in patients aged eighty or older" docx
... 14 Kawashima M, Kagami Y, Toita T, Uno T, Sugiyama M, Tamura Y, Hirota S, Fuwa N, Hashimoto M, Yoshida H, Shikama N, Kataoka M, Akuta K, Sasaki K, Tamamoto T, Nemoto K, Ito H, Kato H, Yamada S, ... Pignon JP, MetaAnalysis of Radiotherapy in Carcinomas of Head and neck (MARCH) Collaborative Group: Hyperfractionated or accelerated radiotherapy in head and neck cancer: a meta-analysis Lancet 2006, ... (ulceration lasting months or more) and/or bone (bone exposure and necrosis) reactions occurred Statistical Analysis For a statistical analysis, a Student’s t-test for normally distributed data and...
- 7
- 367
- 0
Báo cáo y học: " Is distortion of the bioprosthesis ring a risk factor for early calcificatio" docx
... this article as: Cereijo et al.: Is distortion of the bioprosthesis ring a risk factor for early calcification? Journal of Cardiothoracic Surgery 2010 5:77 Author details Department of Cardiovascular ... Cardiovascular Surgery, Santiago de Compostela University Hospital La Choupana, Santiago de Compostela 15706, Spain 2Department of Radiology, Santiago de Compostela University Hospital La Choupana, Santiago ... problems at implantation [6] or compression Figure Radiographic evaluation showed a misshapen bioprosthesis ring Figure Preoperative coronary angiography showed a misshapen bioprosthesis ring Table...
- 3
- 370
- 0
Báo cáo y học: "Early postoperative hyperglycaemia is not a risk factor for infectious complications and prolonged in-hospital stay in patients undergoing oesophagectomy: a retrospective analysis of a prospective trial" ppsx
... data collection, data analysis and writing of the manuscript JHDV participated in data analysis and writing of the manuscript JBH participated in the design of the study, data collection, data ... Hyperglycaemia has vasoconstrictive effects [22], which may aggravate tissue ischaemia, particularly in patients with obstructive vascular disease Insulin has been reported to have vasodilatory ... hyperglycaemia is more likely to be a risk marker than a risk factor in a patient group encountering severe surgical stress but with a low prevalence of cardiovascular disease We therefore suggest that...
- 6
- 368
- 0
Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx
... the available data and method of data retrieval The purpose of this review is to establish, from recent research, if there is a causal link between obesity and the affliction of low back pain A ... with low back pain, in particular with chronic or recurrent low back pain [27] What appears to be a main concern in linking obesity as a causal factor for low back pain is the numerous variables ... diagnoses used to explain back symptoms Annular tear Fibromyalgia Spondylosis Degenerative joint disease Disc derangement/disruption Adult spondylolysis Disc syndrome Lumbar disc disease Sprain...
- 6
- 402
- 0
HEPATOCYTE GROWTH FACTOR IS a MAJOR CYTOKINE FOR NSC HOMING TO GLIOMA
... endothelial barrier [53] In addition, HMGB1 acts as a pro-inflammatory factor, and is released by damaged cells as a chemoattractant for vascular smooth muscle cells and fibroblasts and induces ... A major obstacle of utilizing NSCs in clinical applications is the need for fetal brain tissue There is limited availability of fetal tissue and it raises multiple moral and ethical complications ... normal Matrigel than on growth factor reduced Matrigel Laminin is the most favorable substrate allowing NSC migration It is suggested that glioma modulated ECM may act as a local guidance for NSC...
- 128
- 211
- 0
def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio
... developmental studies in vertebrate Zebrafish has many advantages over other vertebrate organisms Firstly, rapid external development makes translucent embryos available for visual analysis of tissue formation ... morphogenesis in zebrafish 1.3.4.1 Exocrine and endocrine pancreas in zebrafish Like the mammalian pancreas, zebrafish pancreas is also composed of two tissues, endocrine pancreas and exocrine pancreas, ... ventral foregut with competency to follow a hepatic fate through actions of the transcription factors Hnf3 (hepatocyte nuclear factor- 3, also FoxA, forkhead box A) and GATA-4 (Bossard and Zaret,...
- 199
- 296
- 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
... Frisen J, Yates PA, McLaughlin T, Friedman GC, O’Leary DD & Barbacid M (1998) Ephrin -A5 (AL1 ⁄ RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual ... of anti-placental alkaline phosphatase-agarose (anti-PLAP; Sigma) was packed into an FPLC column (Amersham Biosciences, Chalfont St Giles, UK) Purification of FN3d–AP was carried out using an AKTA ... cleavage sites (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated...
- 14
- 669
- 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast ... Zymed (San Francisco, CA, USA) Horseradish peroxidaseconjugated goat anti-(mouse IgG) and gel-filtration standards were from Bio-Rad Laboratories (Hercules, CA, USA) Penta His mAb and Ni-NTA agarose ... the AAA superfamily typically contain one or two ATPase domains that assemble into one or two stacked hexameric rings The ATPase catalytic site is located at the interface between adjacent ATPase...
- 23
- 490
- 0
Báo cáo khoa học: Combining theoretical analysis and experimental data generation reveals IRF9 as a crucial factor for accelerating interferon a-induced early antiviral signalling pdf
... estimate distributions obtained for each gene on each array when performing RMA analysis Normalization ensures that the median standard error across all arrays is for each gene Problematic chips are ... signaling through a novel mechanism involving nuclear accumulation of interferon regulatory factor J Virol 83, 2178–2187 Nakao K, Nakata K, Yamashita M, Tamada Y, Hamasaki K, Ishikawa H, Kato ... increasing ligand concentrations result in earlier maximal pathway activation and an increase in signal amplitude [3,4] Furthermore, alterations in the activity of a kinase or phosphatase may affect...
- 14
- 432
- 0
Báo cáo khoa học: The highly conserved extracellular peptide, DSYG(893–896), is a critical structure for sodium pump function docx
... 5¢-GTGGAGGACATCTATGGGCAGCAG-3 Gly896fiArg 5¢-GTGGAGGACAGCTATAGGCAGCAG-3¢ Gly896fiIle 5¢-GTGGAGGACAGCTATATCCAGCAG-3¢ a Second primer for all of the above 5¢-GTCATTAATCCAACGGTCATCCCA-3¢ Primers used for ... 5¢-GTGGAGGACAGCTATGGGCAGCAG-3¢ Wild type Asp893fiArg 5¢-GTGGAGCGCAGCTATGGGCAGCAG-3¢ Asp893fiGlu 5¢-GTGGAGGAGAGCTATGGGCAGCAG-3¢ Asp893fiAla 5¢-GTGGAGGCCAGCTATGGGCAGCAG-3¢ Ser894fiAsp 5¢-GTGGAGGACGACTATGGGCAGCAG-3¢ Ser894fiIle ... properties, although in somewhat different ways In general, however, we can distinguish between catalytically inactive and catalytically active mutants Catalytically inactive mutants All mutants of Asp893...
- 11
- 318
- 0
Báo cáo khoa học: Human delta-lactoferrin is a transcription factor that enhances Skp1 (S-phase kinase-associated protein) gene expression pdf
... CCCAGTCCCATCCCAGAGGCCATCTCTGGTTTCTTCAGGG S: GTGCTGTTAGCCCTTATTTCCTACTATTAAAGAGGCTTCCATGCCAAACATAGCC F: GGCTATGTTTGGCATGGAAGCCTCTTTAAATAGTAGGAAATAAGGGCTAACAGCAC S: CTAGTGTCTGATGCTGCAACCACCGCCAC F: GTGGCGGTGGTTGCAGCATCAGACACTAG ... GTGTGGCAGGACGCTGCGCCTTTCACAG F: CTGTGAAAGGCGCAGCGTCCTGCCACAC S: TCCCAGAGGCACTGTACATCTCTG F: CAGAGATGTACAGTGCCTCTGGGA S: GCCTCTTTAGAAGTCAATAGTAGG F: CCTACTATTGACTTCTAAAGAGGC S: GCCTCTTTAGAAGATCAAAAGTAGG ... External S: GAGACTGGATAGGCTTGTAG External F: GCGCCGAGGACCCCG Internal S: ACAAAGACCTGGTAACTCA Internal F: GAACCTTACTCCACAATTAG S: CCCTGAAGAAACCAGAGATGGCCTCTGGGATGGGACTGGG F: CCCAGTCCCATCCCAGAGGCCATCTCTGGTTTCTTCAGGG...
- 16
- 363
- 0
Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx
... or His137, residues acting as the general acid and base on the catalysis by a- sarcin [19,20], rendered proteins with no detectable activity against ApA [20] Cleavage of ApA by a- sarcin is a low-specificity ... plays an important role in the rRNA catalytic cleavage by a- sarcin, which would not be simply related to the bearing positive charge Both mutant variants of a- sarcin cleave ApA, with slight variation ... proposed that the mechanism of action of a- sarcin against ribosomes might differ in some details from that against dinucleotides [18,19] The behaviour of a- sarcin against ApA as a function of pH, altogether...
- 7
- 434
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25