nibrin is associated in a trimeric complex with hmre11 and hrad50

Báo cáo y học: "Cytomegalovirus-associated splenic infarcts in a female patient with Factor V Leiden mutation: a case report" docx

Báo cáo y học: "Cytomegalovirus-associated splenic infarcts in a female patient with Factor V Leiden mutation: a case report" docx

Ngày tải lên : 11/08/2014, 19:21
... Journal of Medical Case Reports 2008, 2:385 abdominal examination There was no lymphadenopathy or meningismus on physical examination A papular rash was apparent on her lower limbs Laboratory ... authors declare that they have no competing interests Authors' contributions LA, DJ and NM analyzed and interpreted the patient data NS, TC and YA wrote the manuscript All authors read and approved ... fever accompanied by splenic infarcts in an immunocompetent patient can be seen in endocarditis, in viral infections such as EBV, in infectious vasculitis as observed in neisserial infections, and...
  • 3
  • 400
  • 0
Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

Ngày tải lên : 25/10/2012, 11:40
... intramuscular antibiotic and antiphlogistic therapy was scheduled (cefazolin sodium 2g/day and ketoprofen lysine salt 200mg/day) Figure 1: proband’s karyotype (G banding technique - GTG) (Seabright,1971) ... hematological investigation and after the assessment of 380 radiographic exams, such as X-Ray Dental Panoramic Tomogram and Denta-Scan (Fig 6) of the inferior maxillary bone Exodontia led to remission ... analyzed family unit, even if in varying degrees, makes the Authors believe in an autosomic dominant transmission of the character, in consideration of the vertical and gender-independent transmission...
  • 7
  • 597
  • 0
Modeling ammonia-nitrogen degradation in a polluted stream with biofilm technique

Modeling ammonia-nitrogen degradation in a polluted stream with biofilm technique

Ngày tải lên : 05/09/2013, 09:38
... factor, and its value lies between and The value is bigger when transporting resistance of ammonia-nitrogen is small and transporting speed is large, inversely the value is smaller ξ is relevant ... examining, total amount of bacteria, nitrobacteria counting, alga differentiating and counting, DO, velocity of flow, water level, temperature and pH MODELING AMMONIA-NITROGEN BIODEGRADATION Ammonia-nitrogen ... stream was described with Monod dynamic equation and hydraulic characteristic of the stream, and modified and evaluated by analyzing biodegradation effect in different periods and environmental...
  • 9
  • 357
  • 0
An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs

An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs

Ngày tải lên : 05/09/2013, 16:10
... with reasonable accuracy In a recent study, Cho et al [12] investigated the effect of a gap in the inclined rib on heat transfer in a square duct and reported that a gap in the inclined rib accelerates ... and Murata A “Effects of rib arrangements on heat transfer and flow behavior in a rectangular rib roughened passage” International Journal of Heat and mass transfer; 123: 675-681, 2001 [6] Lau ... XVII National and VI ISHME/ASME Heat and Mass Transfer Conference, IGCAR, Kalpakkam India 2004; Jan 05-07 [2] Han J C “Heat transfer and friction in channels with two opposite rib roughened walls”,...
  • 12
  • 831
  • 0
Tài liệu Báo cáo khoa học: The crystal structure of coenzyme B12-dependent glycerol dehydratase in complex with cobalamin and propane-1,2-diol pptx

Tài liệu Báo cáo khoa học: The crystal structure of coenzyme B12-dependent glycerol dehydratase in complex with cobalamin and propane-1,2-diol pptx

Ngày tải lên : 21/02/2014, 03:20
... were amplified by PCR using pairs of primers 5¢-CATATGCAACAGACAACCCAAATTCAGCCC-3¢ and 5¢-AGATCTTATCACTCCCTTACTAAGTCGATG-3¢ for the b subunit and 5¢-CATATGAGCGAGAAAACCA TGCGCGTGCAG-3¢ and 5¢-AGATCTTAGCTTCCTTT ... DNA polymerase (Stratagene) and pairs of primers 5¢-TCTGAGTGCGGTGGAAGAGATG ATGAAGCG-3¢ and 5¢-AGATCTTATTCAATGGTGT CGGGCTGAACC-3¢ and digested with EcoRV and BglII Resulting 210-bp fragment was ... in a five-coordinated, square-pyramidal complex, suggesting again that the bound cobalamin is actually cob(II)alamin Substrate- and K+-binding sites Substrate propane-1,2-diol and the essential...
  • 11
  • 602
  • 0
Báo cáo khoa học: Fluorescence studies of the replication initiator protein RepA in complex with operator and iteron sequences and free in solution pdf

Báo cáo khoa học: Fluorescence studies of the replication initiator protein RepA in complex with operator and iteron sequences and free in solution pdf

Ngày tải lên : 07/03/2014, 04:20
... GAACAAGGACAGGGCATTGACTTGTCCCTGTCCCTTAAT ATACCCGGGTTTAAAGGGGACAGATTCAGGCTGTTATCCACACCC GCCCGGGTTTAAAGGGGACAGATTCAGGCC A D B E C F 5396 Fig Excitation spectra (kem = 480 nm) of AEDANS C160RepA with ... and dimeroperator complexes are available, indicating secondary structural changes in the linker connecting the dimerization and DNA-binding domains, and rearrangement of the relative orientation ... 6ị In this instrumental setup, G is a scaling factor which is independent of the emission wavelength and, in general, has values near It takes in account small instabilities of the laser and...
  • 15
  • 431
  • 0
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_2 pptx

Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_2 pptx

Ngày tải lên : 14/03/2014, 23:20
... This one is kind of cautionary, and kind demanding than isolation exercises, breaking of commonsense Few of you will want to down more muscle tissue and requiring more the same exercises over and ... easy for anyone reading this, but the total-body program is in another league If training programs were animals, HFT for Arms would be a pit bull- a tough sumbitch by any standard- while Total-Body ... you're targeting But as of your elbow joints than they can handle THEPLANS The easiest fix is to use a variety of hand fifth week Rather than taking the entire week positions-neutral (palms facing...
  • 112
  • 530
  • 1
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_3 pot

Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_3 pot

Ngày tải lên : 14/03/2014, 23:20
... find a stand-alone dip station Other times it's part of a device called the "captain's chair" that is used for an ab exercise resembling the hanging leg raise Newer gyms have a machine for assisted ... vertical than you can with a traditional squat, and thus increase your range of motion UP: Return to the starting position and exhale 242 VARIATIONS: 2» 1» FAST PARTIAL FRONT SQUAT SUPRAMAXIMAL ... Strong, Phases lA, 2A , and 3A; Get Even Stronger, Phases lA, 2A, and 3A; Get Lean, Phases lA, 2A, and 3A HOW TO DO IT: Set the bench to a 45-degree incline Grab two dumbbells and lie faceup on...
  • 98
  • 452
  • 1
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_4 pptx

Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_4 pptx

Ngày tải lên : 22/03/2014, 16:21
... digest any type of food made in a linoleic acid (CLA) is a good fat that also lab Typical reactions include bloating, diar- happens to be a naturally occurring trans fatty rhea, and gas I mean really, ... explain as I already said is measured in calories Your that in more detail in the next chapter.) That's brain and heart and all the other working parts why few of us are in energy balance on an ... target into two servings Again, having them with breakfast and dinner is easiest Monounsaturated fats are also important, up overfed and undernourished In particular, I see this repetitive cycle with...
  • 57
  • 391
  • 1
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_1 doc

Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_1 doc

Ngày tải lên : 22/03/2014, 16:21
... intellectual deadlift, and nobody ever asks you about that challenge as well as a physical pursuit You read Then one day, without meaning to, you more about training, gaining a working knowl- come across ... modest change in muscle tension But, as I explained in Chapter 1, those small fibers can maintain that modest increase in tension for a long time That comes in handy when we're talking about hands ... training That is, I think you should train muscleheads all your major muscles three times a week And The exercise photos and instructions if you want to get really big and are willing to appear...
  • 103
  • 552
  • 2
Báo cáo khoa học: The potyviral virus genome-linked protein VPg forms a ternary complex with the eukaryotic initiation factors eIF4E and eIF4G and reduces eIF4E affinity for a mRNA cap analogue ppt

Báo cáo khoa học: The potyviral virus genome-linked protein VPg forms a ternary complex with the eukaryotic initiation factors eIF4E and eIF4G and reduces eIF4E affinity for a mRNA cap analogue ppt

Ngày tải lên : 23/03/2014, 10:21
... substituted with an alanine As expected, this substitution abolished m7GDP binding to W12 3A while retaining its capacity to associate with VPg (Table 1) The VPg surface defining the zone of interaction with ... being washed, the fraction eluted with glutathione was analysed By SDS ⁄ PAGE contained this protein (Fig 4A, lane 3) As the interaction of VPg with plant translation initiation factors was suspected, ... 260 kDa; Fig 4A, compare lanes 3, and 5) The intermediate band (% 80 kDa) observed in native conditions contained VPg and eIF4E but not eIF4G (Fig 4A, compare lanes and with 5) It was attributed...
  • 11
  • 489
  • 0
Báo cáo khoa học: Structures of Phanerochaete chrysosporium Cel7D in complex with product and inhibitors ppt

Báo cáo khoa học: Structures of Phanerochaete chrysosporium Cel7D in complex with product and inhibitors ppt

Ngày tải lên : 23/03/2014, 13:20
... configuration-retaining glycosidases Angewandte Chemie-Int Edition 38, 750–770 34 Panday N & Vasella A (1999) Synthesis of glucose- and mannose-derived N-acetylamino imidazopyridines and their evaluation as inhibitors ... of Arg240 in binding to O5 and O6 in the +1 site is thus assumed by Arg251 in Tr_Cel 7A The main˚ chain atoms of Arg251 are  A away from those of Arg240, but the functional guanidino groups are ... The guanidino group of that side chain has rotated slightly, so that it interacts with O4 and O5, instead of O5 and O6 (Fig 3B) At the same time, Arg240 can make more favourable interactions with...
  • 13
  • 421
  • 0
Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx

Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx

Ngày tải lên : 24/03/2014, 04:21
... mounting evidence that in ammatory cell in ltrates play a significant role in driving the pathogenesis of asthma and other allergic diseases by damaging tissue and releasing pro -in ammatory agents ... as sialidase often interrupts binding In particular, an arginine residue within the first Ig domain is a key aminoacid residue for binding to SIA [2] Comparison of the N-terminal Ig-like domain ... Emt and ZAP-70 kinases or left untreated, and incubated with cell lysate GST proteins and associated proteins were recovered by binding to glutathione– Sepharose, separated by SDS/PAGE, and analyzed...
  • 14
  • 540
  • 0
– THE GRE QUANTITATIVE SECTION – The area of a sector is found in a similar way to finding the pptx

– THE GRE QUANTITATIVE SECTION – The area of a sector is found in a similar way to finding the pptx

Ngày tải lên : 18/06/2014, 17:20
... angles are equal and the ratio of the corresponding sides is in proportion Parallelograms A parallelogram is a quadrilateral with two pairs of parallel sides B A C D In this figure, AB ʈ ෆD and BC ... Review Many questions on the GRE will test your ability to analyze data Analyzing data can be in the form of statistical analysis (as in using measures of central location), finding probability, and ... line has a slope of and a vertical line does not have a slope at all—it is undefined Parallel lines have equal slopes Perpendicular lines have slopes that are negative reciprocals Data Analysis Review...
  • 25
  • 410
  • 0
báo cáo hóa học: " A comparison of EQ-5D index scores using the UK, US, and Japan preference weights in a Thai sample with type 2 diabetes" pdf

báo cáo hóa học: " A comparison of EQ-5D index scores using the UK, US, and Japan preference weights in a Thai sample with type 2 diabetes" pdf

Ngày tải lên : 18/06/2014, 19:20
... Tsuchiya A, Williams A, Yfantopoulos J, De Charro F: A comparison of EQ-5D time trade-off values obtained in Germany, United Kingdom, Spain In The measurement and valuation of health status using ... analyzing and collecting the data All authors have read and approved the final manuscript Acknowledgements This research was supported by a grant from Chulalongkorn University The authors thank diabetic ... complications (presence and absence) namely neuropathy, retinopathy, nephropathy and cardiovascular diseases (Table 8) The relative precision values suggest that the Japan weights discriminated...
  • 9
  • 498
  • 1
Báo cáo hóa học: " Evaluation of liver enzyme levels in workers exposed to vinyl chloride vapors in a petrochemical complex: a cross-sectional study" pot

Báo cáo hóa học: " Evaluation of liver enzyme levels in workers exposed to vinyl chloride vapors in a petrochemical complex: a cross-sectional study" pot

Ngày tải lên : 20/06/2014, 00:20
... bilirubin) Lab tests along with the questionnaire data were analyzed with SPSS-10 using the T-test and linear regression analysis Methods This is a cross-sectional analytic study The study was conducted ... Sampling tube method was used and its analysis was performed by Gas chromatography Environmental sampling was done in several consecutive days and during the whole working days, i.e hours Maximum ... screening and surveillance of workers exposed to low level VCM Naturally, liver transaminases and especially ALP and GGT are available, noninvasive and affordable tests for screening of workers exposed...
  • 6
  • 380
  • 0
Báo cáo hóa học: " Bilateral pyosalpinx in a peripubescent female with Hirschsprung’s disease: a case report" docx

Báo cáo hóa học: " Bilateral pyosalpinx in a peripubescent female with Hirschsprung’s disease: a case report" docx

Ngày tải lên : 20/06/2014, 22:20
... pyosalpinx and a history of Hirschsprung’s disease is extremely rare The pathology and Figure CT scan of the abdomen and pelvis with intravenous and oral contrast Swelling and inflammation are shown ... identified that are associated with Hirschsprung disease and the disease has been associated with other congenital abnormalities Five percent of all cases are associated with Down syndrome [1] In one ... pyosalpinx are Chlamydia and enteric bacteria [1] Hydrosapinx has been associated with less common organisms including pneumococcus, streptococcus, and shigelloides and is seen in non sexually active...
  • 3
  • 293
  • 0
Báo cáo hóa học: " Exertional heat stroke in a marathon runner with extensive healed deep burns: a case report" ppt

Báo cáo hóa học: " Exertional heat stroke in a marathon runner with extensive healed deep burns: a case report" ppt

Ngày tải lên : 21/06/2014, 05:20
... was left with only about half of her body surface area able to dissipate heat by perspiration and vasodilation This was probably not enough to maintain normothermia during her marathon endeavour ... of has always been emphasised This is because it is presumed that the increased heat production and the resultant increase in the core body temperature will drive the peripheral vasodilation and ... of the same day She was eventually discharged with advice to refrain from participating in any such endurance events because of her singular physiology Discussion Heatstroke is traditionally divided...
  • 3
  • 220
  • 0
Báo cáo toán học: " For each α 2 there is an infinite binary word with critical exponent α" docx

Báo cáo toán học: " For each α 2 there is an infinite binary word with critical exponent α" docx

Ngày tải lên : 07/08/2014, 15:22
... tends to in nity However, for α > 7/3, Shur [9] gave a construction over a binary alphabet For α > 2, Krieger and Shallit gave a construction over a four-letter alphabet and left it as an open ... Theorem and induction, 0r−1 v contains a κ-power This is impossible by Lemma Suppose then that δ t µs (0r v) contains a κ-power u of period q, κ ≥ α Using induction ˆ r and Theorem 3, v contains a ... 2, this means that 0001 is a subword of u at least twice, so that 0001 is a subword of 00v This is impossible, since 00v ∈ L Therefore, 0p is a prefix of u, and u has the form 0t for some integer...
  • 5
  • 260
  • 0
Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc

Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc

Ngày tải lên : 09/08/2014, 04:21
... left breast with combined histological features of lobular carcinoma and infiltrating ductal carcinoma The family history suggested LFS: the patient's father was diagnosed with dorsal soft tissue ... generation of a shorter p53 protein with a different amino acid sequence in its carboxy terminal portion This means that the DNA binding domain, oligomerization domain, and nuclear localization ... genetic counseling and possibly clinical management Patients and Methods Family The family studied is of Mexican origin The index case was a 23-year-old female diagnosed with breast carcinoma of the...
  • 7
  • 403
  • 0