... transcript, of 2 kb, is produced [29]. The trout IL-11gene gives rise to a single transcript of 3.2 kb in RTScells, as seen in the northern blot (Fig. 7), and is the largest ofthe known IL-11 ... differ-ences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG(31 bp) in the 3¢-UTR ofthe cDNA sequence (Fig. 1).A ... in the 5¢-UTR, and four potentialpoly(A) signals were found in the 3¢-UTR (Fig. 1), two of them just 14 or 23 bp upstream ofthe poly(A) tail. The remaining two poly(A) signals were upstream of the...
... the high values. The other uses the annual series which consists only ofthe highest value for each year. The highest value of record, of course, is the top value of each series, but ... the hydrologic network data. The results of this work showed the importance ofthe additional data in defining the short-duration rainfall frequency regime in the moun-tainous regions of ... by-product of previous work performed for the Corps of Engineers, was the first paper published under the sponsorship ofthe Soil Conservation Service. This paper contains a series of rainfall...
... are drawn from the councils of the National Academy of Sciences, the National Academy of Engineering, and the Insti-tute of Medicine. The members ofthe committee responsible for the report were ... extend the lifetime of TRMM beyond the originalanticipated maximum length ofthe mission thereby enhancing the value of the data from TRMM to science and operations. The committee found the following:• ... somemirror-image, and the precipitation in a column at least 18 km above the surface. (A margin isneeded because ofthe oblateness ofthe Earth and the slight eccentricity ofthe orbit and also...
... and the y-intercept ofthe theoretical line (–0.095 and 27.00, re-spectively) fell in the confidence interval (95%) ofthe slope(−0.084 ± 0.024) and the y-intercept (26.87 ± 1.56) ofthe re-lationship ... standard error ofthe species mean. The grey lines represent the upper and lower confidence interval limits (95%) ofthe relation-ship between ∆ and WUE. The Symbols correspond to the succes-sional ... ∆ and WUE.There was a strong positive and linear relationship between∆ of sunlit leaves of dominant canopy trees and the leaves of potted seedlings ofthe same species grown in the glasshouse(P...
... biomass production per unit of absorbed nutrient is simply the inverse of the concentra-tion of the nutrient in question in the tissues of the plant.However, in long-lived ... [38],increasing the NUE. Resorption is the repeated use of the same nutrient units and could therefore be a good means of estimating the efficiency of nutrient use; neverthelessresorption ... therefore, the nature of the underlying sub-strate does seem to have some effect on the P resorption.Furthermore, it is necessary to take the general abun-dance of...