nghiên cứu the influence of corporate culture on organisational commitment a study on a malaysian listed company của nhóm tác giả zahariah et al 2009

the influence of corporate culture of vietnamese companies a study of corporation fpt

the influence of corporate culture of vietnamese companies a study of corporation fpt

Ngày tải lên : 13/03/2014, 14:20
... alive the primary values of the corporate Storytelling is a powerful tool in organizational learning as well in that they communicate implicitly organizational values It also plays an important ... that control the management of the company They also represent the institutional philosophy and the support to the culture of an organization The main objective of core values is to have a framework ... analyzed, compared the data with basic theory and gave out the evaluation and advice 3.3 Limitations of thesis This thesis has some limitations The first limitation is that the research is conducted...
  • 77
  • 1.4K
  • 14
The influence of organizational culture on employee commitment in german companies in ho chi minh city

The influence of organizational culture on employee commitment in german companies in ho chi minh city

Ngày tải lên : 23/10/2015, 15:38
... exert considerable effort on behalf of the organization; and a strong desire to maintain membership in the organization a strong belief in and acceptance of the organization‘s goals and values a willingness ... refers to an employee‘s belief in the organization‘s goals and values, desire to remain a member of the organization and loyalty to the organization Mowday, et al. , 1982; and Hackett, et al, 2001) ... 2003) In a study of Hong Kong and Australian managers, Lok and Crawford (2004) found a positive effect of corporate culture on organizational commitment Zain et al (2009) examined the effect of four...
  • 107
  • 588
  • 3
the effects of corporate culture on organisational effectiveness at general department of vietnam customs

the effects of corporate culture on organisational effectiveness at general department of vietnam customs

Ngày tải lên : 13/12/2017, 23:41
... companies place a great deal of emphasis on their values Hofstede (1980)‘s study indicates that cultural values reliably distinguish national subsidiaries of a multinational corporation Values ... the company trademark also contributes a part of their own brands Trademark always reminds employees about the organisational vision, common goals as well as their missions to achieve those goals ... something about the organization These symbols can be as concrete as a name and as abstract as cleanliness, high tech, modernity, or quality They take all strong measures of the company These are values...
  • 59
  • 115
  • 0
Báo cáo nghiên cứu khoa học: " THE IMPACT OF BUREAUCRATIC CULTURE ON MARKETING KNOWLEDGE TRANSFER WITHIN INTERNATIONAL JOINT VENTURES" pot

Báo cáo nghiên cứu khoa học: " THE IMPACT OF BUREAUCRATIC CULTURE ON MARKETING KNOWLEDGE TRANSFER WITHIN INTERNATIONAL JOINT VENTURES" pot

Ngày tải lên : 22/07/2014, 06:20
... Destan K & Tomas G M H, A conceptualization of an organizational learning culture in international joint ventures, Industrial marketing management, 34, 430439, (2005) [6] Hauke, A. , Impact of ... He considered bureaucracy as the ideal type of such formal organizations which are efficient, rational and honest Moreover, according to Jarvis (2003), bureaucratic culture has the great capacity ... collaboration, cooperation and participative decision making More than that; by building on the knowledge of various team members, teams facilitate the exchange and internalization of knowledge and...
  • 7
  • 410
  • 0
Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding

Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding

Ngày tải lên : 03/11/2012, 09:57
... TBS) A monoclonal mouse IgG1anti human anti-HLA-DR [CR3/43] was added at a concentration of 1ug/ml (Dako, Denmark), the membranes were then washed, and incubated with the secondary detection antibody, ... increased the shedding of HLA-DR from the cell surface and also increased HLA-DR gene transcription may have implications for the therapy of septic patients with GM-CSF as these trials have already ... Select software (DNA Star) Forward HLA-DR Primer: ATCATGACAAAGCGCTCCAACTAT Reverse HLA-DR Primer: GATGCCCACCAGACCCACAG (Sigma, UK) Soluble HLA-DR measurement by ELISA Ninety six well ELISA plates...
  • 11
  • 618
  • 0
THE INFLUENCE OF HUMAN ACTIVIES ON THE ENVIRONMENT

THE INFLUENCE OF HUMAN ACTIVIES ON THE ENVIRONMENT

Ngày tải lên : 28/09/2013, 11:10
... traps heat in the atmosphere and causes the temperature of the earth to rise • This leads to disruption of the weather patterns eg drought, floods • Some weeds may thrive on the extra carbon ... Improvements in agriculture health and medicine have produced a dramatic rise in the human population This increase in population size leads to an increase in pollution and higher demand for the world’s ... manure as a fertiliser and set aside land for growth of wild plants Biological Control of Pests • This means using natural predators to eat pests instead of pesticides • It does not have harmful...
  • 23
  • 390
  • 0
Tài liệu The Influence of Human Activity on the Environment ppt

Tài liệu The Influence of Human Activity on the Environment ppt

Ngày tải lên : 26/01/2014, 10:20
... traps heat in the atmosphere and causes the temperature of the earth to rise • This leads to disruption of the weather patterns eg drought, floods • Some weeds may thrive on the extra carbon ... Improvements in agriculture health and medicine have produced a dramatic rise in the human population This increase in population size leads to an increase in pollution and higher demand for the world’s ... manure as a fertiliser and set aside land for growth of wild plants Biological Control of Pests • This means using natural predators to eat pests instead of pesticides • It does not have harmful...
  • 23
  • 690
  • 0
Báo cáo " Assessment of the influence of interpolation techniques on the accuracy of digital elevation model " potx

Báo cáo " Assessment of the influence of interpolation techniques on the accuracy of digital elevation model " potx

Ngày tải lên : 05/03/2014, 16:20
... weights are based not only on the distance between the measured points and the prediction location but also on the overall spatial arrangement of the measured points To use the spatial arrangement ... type of topography This can be done automatically by analyzing the variation of elevation by using statistical indicators, such as variance or standard deviation Conclusions Interpolation technique ... in the weights, the spatial autocorrelation must be quantified through empirical semivariograms The semivariogram can have one of the following models: circular, spherical, exponential, gaussian,...
  • 8
  • 464
  • 1
Báo cáo khoa học: "An Empirical Study of the Influence of Argument Conciseness on Argument Effectiveness" docx

Báo cáo khoa học: "An Empirical Study of the Influence of Argument Conciseness on Argument Effectiveness" docx

Ngày tải lên : 08/03/2014, 05:20
... user’s autonomous exploration of the set of alternatives and the selection of the preferred alternatives Let’s examine now how an argument generator can be evaluated in the context of the selection ... data exploration and analysis (IDEA) (Roth, Chuah et al 1997) The IDEA environment provides the user with a set of powerful visualization and direct manipulation techniques that facilitate the ... performs aggregation, pronominalization and makes decisions about cue phrases and scalar adjectives, along with a sentence realizer, which extends previous work on realizing evaluative statements...
  • 8
  • 402
  • 0
Research Gaps and Measurement Challenges for Studying the Influence of New Media on Adolescent Sexual Health docx

Research Gaps and Measurement Challenges for Studying the Influence of New Media on Adolescent Sexual Health docx

Ngày tải lên : 30/03/2014, 05:20
... social media use on youth sexual health is also a top priority Studies of the effects of social media are the top priority for research in the area of new media and adolescent sexual health Panelists ... effects of media exposure and media-based sexual health intervention on youth sexual health outcomes Although many of these aspects of new media and their potential effects on behavior can be derived ... field as “social mediation.” It is has been found to alter the effects of exposure to media content Social mediation of media effects happens with traditional media as well but typically among a...
  • 13
  • 414
  • 0
the influence of financial pressure on academic administrators' selection of management and resource allocation strategies

the influence of financial pressure on academic administrators' selection of management and resource allocation strategies

Ngày tải lên : 03/06/2014, 02:16
... permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced ... permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced ... permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced...
  • 262
  • 310
  • 0
Báo cáo hóa học: " Applying the scientific method when assessing the influence of migratory birds on the dispersal of H5N1 Paul L Flint" doc

Báo cáo hóa học: " Applying the scientific method when assessing the influence of migratory birds on the dispersal of H5N1 Paul L Flint" doc

Ngày tải lên : 20/06/2014, 01:20
... relative to the potential risk to the poultry industry and human health, it would seem that prematurely dismissing a potential carrier for dispersal has the potential to allow this virus to expand ... null that is false) Uninformative conclusions drawn from valid results Finally, throughout the debate on the respective roles of migratory and domestic birds in the dispersal of H5N1, there are ... these examples, while the original statements may be strictly true, the conclusions drawn from them are not necessarily valid or informative Conclusion As the debate regarding the role of wild...
  • 3
  • 245
  • 0
Báo cáo hóa học: " The influence of colloidal parameters on the specific power absorption of PAA-coated magnetite nanoparticles" potx

Báo cáo hóa học: " The influence of colloidal parameters on the specific power absorption of PAA-coated magnetite nanoparticles" potx

Ngày tải lên : 21/06/2014, 03:20
... Balakrishnan S, Wang X, Mao H, Hadjipanayis GC: Metallic Iron Nanoparticles for MRI Contrast Enhancement and Local Hyperthermia Small 2008, 4:1925 Andra W, Nowak H: Magnetism in Medicine A Handbook ... in the SAR dependence of the particle concentration between the bare and PAA coated particles can be attributed to the active role played by the PAA shell The PAA coating not only stabilizes the ... discussion and drafted the manuscript IP-B participated in the synthesis and chemical characterization of the samples GG was involved in the design and fabrication of the hyperthermia equipment, participated...
  • 7
  • 396
  • 0
Khóa luận tốt nghiệp tiếng anh:THE INFLUENCE OF SERVICE QUALITY ON CUSTOMER SATISFACTION IN THE FOOD  BEVERAGE INDUSTRY IN VIETNAM: A CASE STUDY IN THE SYSTEM THE GIOI NGHIENG 2305 RESTAURANTS

Khóa luận tốt nghiệp tiếng anh:THE INFLUENCE OF SERVICE QUALITY ON CUSTOMER SATISFACTION IN THE FOOD BEVERAGE INDUSTRY IN VIETNAM: A CASE STUDY IN THE SYSTEM THE GIOI NGHIENG 2305 RESTAURANTS

Ngày tải lên : 05/07/2014, 10:08
... displays the individual values of the percentage of variance explained (57.20% of total variance) Table 4: Total Variance Explained Extraction Sums of Squared Component Total % of Cumulative Variance ... Extraction Method: Principal Component Analysis 36 Table shows the rotated component matrix (also known as factor rotation matrix in factor analysis) is a matrix of load factors for each variable ... quality, ustomers’ satisfaction, and the relationship of the these factors Based on these studies, the impact materials have on service quality on customer satisfaction in the food & beverage...
  • 52
  • 2K
  • 3
Báo cáo lâm nghiệp: "The influence of selected factors on energy requirements for plain milling of beech wood" ppsx

Báo cáo lâm nghiệp: "The influence of selected factors on energy requirements for plain milling of beech wood" ppsx

Ngày tải lên : 07/08/2014, 03:22
... values of both these materials are presented in Table and in Figs 5–8 It follows from the statistical evaluation by multifactor analysis of variance that the influence of all observed factors on ... actual value of voltage U and on the basis of the recorded phase shift (3rd phase) the equipment is able to evaluate the input of an electric motor; the recorded values were in an interval of ... in any of these cases in the given combination of studied parameters; a higher J FOR SCI., 56, 2010 (5): 243–250 value of cutting input was always reached in materials with false heart The main...
  • 8
  • 434
  • 2
Báo cáo lâm nghiệp: " The influence of Picea abies on herb vegetation in forest plant communities of the Veporské vrchy Mts" ppt

Báo cáo lâm nghiệp: " The influence of Picea abies on herb vegetation in forest plant communities of the Veporské vrchy Mts" ppt

Ngày tải lên : 07/08/2014, 10:21
... as Maianthemum bifolium, Veronica officinalis and already mentioned Oxalis acetosella and Soldanella montana are present Calamagrostis arundinacea, Chrysosplenium alternifolium, Stellaria nemorum ... Relation between the proportion of Picea abies and other variables including EIV (CCA with the proportion of Picea abies as the only environmental variable and altitude and slope as covariables); ... MATERIALS AND METHODS Study area The Veporské vrchy Mts are situated in the central part of Slovakia and belong to the central West Carpathians The studied area covers approximately 800 km2 The...
  • 10
  • 428
  • 0
Báo cáo khoa học: "The influence of seed age on germinative response to the effects of fire in Pinus pinaster, Pinus radiata and Eucalyptus globulus" doc

Báo cáo khoa học: "The influence of seed age on germinative response to the effects of fire in Pinus pinaster, Pinus radiata and Eucalyptus globulus" doc

Ngày tải lên : 08/08/2014, 14:21
... statistically treated using Multivariant Variance Analysis In order to increase normality, the germination percentage data was transformed using an Arc-sine Transformation, and the average germination ... species of pines and eucalyptus In both P pinaster and P radiata most of the treatments place the peaks of maximum germination between days and 25 These peaks are sharper in P radiata than in P pinaster ... totally linear, there are no important variations in the germination rate over a period of time, or within the different treatments applied The evolution of the germination rate of P radiata at...
  • 10
  • 334
  • 0
Báo cáo toán học: "Modelling variability of within-ring density components in Quercus petraea Liebl. with mixed-effect models and simulating the influence of contrasting silvicultures on wood density Édith Guilley a" pot

Báo cáo toán học: "Modelling variability of within-ring density components in Quercus petraea Liebl. with mixed-effect models and simulating the influence of contrasting silvicultures on wood density Édith Guilley a" pot

Ngày tải lên : 08/08/2014, 14:21
... is a diagonal matrix where the covariances are forced to zero The contribution of each tested factor was then evaluated by splitting the total variability of density components into a variation ... σ The ) sub-model (2b) is equal to Δα + where Δα = + ’Region’ effect, &k; ’Radius’ ,ahpla&;atleD &gahpla&;atleDeffect &kahpla&;atleDand; Δα&gkahpla&;atleD ... variation for density components was analysed in 82 oak trees at breast height and the second analysis concentrated on the effect of ring location on the basis of 52 trees in which two radii at...
  • 10
  • 267
  • 0
Báo cáo khoa học: "The influence of wood quality on lumber drying distortion*" potx

Báo cáo khoa học: "The influence of wood quality on lumber drying distortion*" potx

Ngày tải lên : 08/08/2014, 18:21
... mean twist being plotted against levels of each factor and against pairs of factors A regression analysis was then performed, and its associated analysis of variance used to test the statistical ... predictions would be unbiased Model predictions were validated against the validation data (table II) All analyses were performed using the SAS statistical package tial in model RESULTS AND DISCUSSION ... the data available indicated that log diameter alone is the single most important variable in radiata pine Spiral grain was the next most important variable Juvenile wood was closely associated...
  • 12
  • 386
  • 0
Báo cáo khoa học: " Developing and evaluating stereotactic lung RT trials: what we should know about the influence of inhomogeneity corrections on dose" doc

Báo cáo khoa học: " Developing and evaluating stereotactic lung RT trials: what we should know about the influence of inhomogeneity corrections on dose" doc

Ngày tải lên : 09/08/2014, 09:22
... Hiraoka M, Fujino M, Gomi K, Niibe Y, Karasawa K, Hayakawa K, Takai Y, Kimura T, Takeda A, Ouchi A, Hareyama M, Kokubo M, Hara R, Itami J, Yamada K, Araki T: Hypofractionated stereotactic radiotherapy ... of CC calculation Dose to5 the the PTV as a function of the PTV as deterDose to 95% of the PTV as a function of the PTV as determined using the CC calculation Figure patient of the UD (top) and ... Again, large variations 20 CC plan UD plan EPL plan 15 10 PTV Dose to target and critical organs after recalculation The influence of recalculating the UD and EPL plans with the CC algorithm on...
  • 8
  • 300
  • 0