neurobiological and neurogenetic evidence for a link between the alpha7 nicotinic acetylcholine receptor and schizophrenia
Báo cáo y học: "No evidence for an association between the -871 T/C promoter polymorphism in the B-cell-activating factor gene and primary Sjögren''''s syndrome" pptx
... (Sigma-Aldrich, Saint Quentin Fallavier, France) BAFF and βactin mRNA levels were assessed by real-time quantitative PCR using the following primers: 5'-TGAAACACCAACTATACAAAAAG-3' and 5'-TCAATTCATCCCCAAAGACAT-3' ... mRNA level was analyzed using the Mann–Whitney U test The association between BAFF polymorphism and serum gammaglobulin, IgG, and rheumatoid factor levels was analyzed using analysis of variance ... cycles at 95°C for 10 s, 60°C for 15 s and 72°C for 20 s For each run, serially diluted cDNA of K562 cells was used as a quantitative standard To correct for variations in mRNA recovery and the...
- 5
- 401
- 0
Báo cáo y học: " Angiotensin-converting enzyme 2 autoantibodies: further evidence for a role of the renin– angiotensin system in inflammation" potx
... to alter the balance of the renin–angiotensin system to favor the ACE2– Ang-(1–7)–AT7 receptor axis and promote the antifibrotic and anti-inflammatory actions of the heptapeptide, as well as attenuate ... and inflammatory events [5] Pre-eclampsia is associated with circulating autoantibodies against the AT1 protein that act as functional receptor agonists to promote vasoconstriction and inflammation ... inhibition ameliorated the autoimmune inflammation [7] The present findings by Takahashi and colleagues reveal increased expression of circulating ACE2 in patients with vasculopathy utilizing a novel...
- 2
- 364
- 0
Tài liệu Báo cáo khoa học: Activation of the Torpedo nicotinic acetylcholine receptor The contribution of residues aArg55 and cGlu93 ppt
... PTMA acted as a competitive antagonist of these mutant receptors (see Fig 3A) Co-application of PTMA and ACh to the aR55F (Fig 3A) and aR55W (data not shown) receptors resulted in a concentration-dependent ... aR55W (e) and aR55F (s) nAChR Data are normalized to Imax for each individual point The data represent the mean ± SEM from at least three oocytes The data obtained from curve-fitting are summarized ... sites for agonists and competitive antagonists [4,5] It is now generally agreed that these sites lie at the interfaces between the a c and the a d subunits [6] Labeling and mutational studies have...
- 11
- 517
- 0
Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf
... than the mean value for DHbind for complex formation for ActIII–ActV with DNA Assuming that the nature of intercalation with DNA is similar for all the drugs investigated, then the additional ... width at half height) of the heat absorption curve All values of thermodynamic parameters were calculated for mol base pairs, taking an average molecular mass of a DNA base pair as 660 Da Results ... transition of calf thymus DNA and its complexes with ActII/ActV determined from DSC measurements All thermodynamic parameters are calculated per mol of DNA base pairs DH and DS, as well as DHbind and DSbind...
- 8
- 331
- 0
Báo cáo y học: "Hyperuricemia and cardiovascular disease: how strong is the evidence for a causal link" docx
... Sanchez-Lozada LG, Tapia E, Bautista-Garcia P, Soto V, AvilaCasado C, Vega-Campos IP, Nakagawa T, Zhao L, Franco M, Johnson RJ: Effects of febuxostat on metabolic and renal alterations in rats ... by other factors in the cardiovascular disease causal pathway [8] Several large epidemiological studies investigating the association between serum urate levels and cardiovascular mortality have ... causative factor for cardiovascular disease? Or is serum urate a cause for factors that are in the causal pathway for cardiovascular disease (such as hypertension, atherosclerosis, metabolic syndrome)?...
- 7
- 389
- 1
Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx
... 5¢-GCC AGATCCCAAATTAGTGC-3¢; QaTGFbsfR2, 5¢-TGAA ACCACAGCCTCAGTTG-3¢, where ‘s’ and a indicate sense and antisense primers, respectively Accurate amplification of the target amplicon was checked ... (blastula, gastrula, trochophore larvae, D larvae, and 14 days post fertilization larvae, pediveliger larvae and metamorphosing larvae) were used as samples Although Cg-BMPR1 and Cg-TGFbsfR2 transcripts ... BMP/activin pathway in Crassostrea gigas A Herpin et al A Crassostrea gigas C2 domain ALK-6 E fluviatilis C2 domain 77 Crassostrea gigas C1 domain 76 88 Wit D melanogaster ActR-2b H sapiens 92 Activin...
- 17
- 508
- 0
Báo cáo khoa học: Neuroglobin and cytoglobin expression in mice Evidence for a correlation with reactive oxygen species scavenging doc
... expected, as the liver is more tolerant to hypoxia [15] and thus more tolerant to higher H2O2 levels For brain and eyes, there was a gradual increase in the amount of H2O2 after hypoxia and reoxygenation ... (hydroxymethylbilane synthase for brain, eyes and skeletal muscle; small-subunit RNA for liver; and TATA box-binding protein for heart) The relative expression of mRNA was calculated using the comparative threshold ... upregulation gradually increases as a function of time, and reaches maximal levels after 48 h of hypoxia in brain, heart, and liver For muscle, the highest upregulation is also obtained after...
- 6
- 391
- 0
Báo cáo khoa học: Alternative substrates for wild-type and L109A E. coli CTP synthases Kinetic evidence for a constricted ammonia tunnel doc
... mM; and CTPS concentrations ranged between 28 and 120 lgặmL)1 for wild-type and 40160 lgặmL)1 for L10 9A The concentration of GTP was maintained at 0.25 mM for all assays when Gln or Gln analogues ... Figs and Such ratios have been used to characterize the channelling efciency of amidotransferases [41] kcat =Km ịCTP formation Subsaturatingcouplingratioẳ kcat =Km ịglutaminase activity 2ị Saturatingcouplingratioẳ ... synthase [27,55] and Gln phosphoribosylpyrophosphate amidotransferase [25], and the same may be true for CTPS While the presence of a phenylalanine at position 109 may impede the appropriate conformational...
- 9
- 404
- 0
Báo cáo khoa học: Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases ppt
... primers P4 (5¢-atgtagccattgtatttgaaaatgagcaact) and P5 (5¢- agttgctcattttcaaatacaatggctacat), and P6 (5¢- gaacagc cgtatttggccgcttattttgtatc) and P7 (5¢- gatacaaaataagcggccaaa tacggctgttc), respectively, ... pJZ12 In the same manner, the plasmid pJZ11, encoding the mutations C33 1A and C376S, was generated using primers P8 (5¢-ccctacggaaacaac gatcgctgcgactacatgggta) and P9 (5¢-tacccatgtagtcgcagcgatcg ... ttgtttccgtaggg), and P10 (5¢-tgaagctggtgaattatcgattggtggagaa ggg) and P11 (5¢-cccttctccaccaatcgataattcaccagcttca), respectively In order to combine all four mutations, an NdeI fragment containing the...
- 13
- 493
- 0
Báo cáo khoa học: Characterization of a membrane-bound angiotensin-converting enzyme isoform in crayfish testis and evidence for its release into the seminal fluid ppt
... Anopheles gambiae ACEs (AnoACE7 and AnoACE9), which appear to be membrane-bound enzymes [19] However, these forms exhibit two catalytic domains, such as somatic mammalian ACE, whereas Asl-tACE, with ... activity assays To determine the enzymatic activity of the testicular A leptodactylus ACE, an activity assay with a radioactive substrate was performed (see Experimental procedures) We tested the activity ... Lepidoptera, the treatment of adults with the ACE inhibitor, captopril, causes a decrease in egg-laying [9] In Haematobia irritans exigua, a blood meal initiates the strong synthesis of ACE in the...
- 12
- 486
- 0
báo cáo hóa học: " The possible link between the elevated serum levels of neurokinin A and anti-ribosomal P protein antibodies in children with autism" pot
... was observed Statistical analysis The results were analyzed by commercially available software package (Statview, Abacus concepts, inc., Berkley, CA, USA) The data were non-parametric, thus they ... The possible link between the elevated serum levels of neurokinin A and anti-ribosomal P protein antibodies in children with autism Gehan A Mostafa1,2, Laila Y AL-Ayadhi1 Autism Research and ... neurokinin A in autism A more detailed understanding of the interactions between tachykinins and immune cells may provide the basis for the development of new therapies for inflammatory and immunemediated...
- 30
- 522
- 0
Báo cáo toán học: "A Relationship Between the Major Index For Tableaux and the Charge Statistic For Permutations" pptx
... give details that the charge statistic and the inversion statistic not only have the same generating function on Sn , but they in fact have the same generating function on Wλ Lemma For λ = (λ1 ... and D Jackson, Combinatorial Enumeration, Dover Publications, 2004 [5] K Killpatrick, A Combinatorial Proof of a Recursion for the q-Kostka Polynomials, Journal of Combinatorial Theory, Ser A ... [2] S Cho, Major Index for Standard Young Tableaux, ARS Combinatoria 71 (2004) pp 93-99 [3] D Foata and M Sch¨ tzenberger, Major index and inversion number of permutau tions, Math Nachr 83 (1978)...
- 9
- 276
- 0
báo cáo khoa học: " Molecular, genetic and transcriptional evidence for a role of VvAGL11 in stenospermocarpic seedlessness in grapevine" pptx
... junctions For VvAGL11, the oligos are 5-GCAGAAGTTGCCCTCATCGT-3 and 5-AAGCCAAGGAATCACCCATT-3; for the internal reference gene EF1 -a (GSVIVT00024496001-8.4x) the oligos are 5-AGGATGGACAAACCCGTGAG-3 and ... isolate this region are 5-caccTTGTGGCCTTGAAGAAA-3 and 5-CACAATGGAGAGATGTGAGACG-3, and the manufacturers conditions were followed for the PCR, purification and ligation reactions Real-time quantitative ... 5-ATGGGGAGAGGAAAGATCGA-3 and 5-TACCCGAGATGGAGGACCTT-3, and the PCR conditions were the same as described above Bands of the expected size (671 bp) were cut from agarose gels and purified and cloned as...
- 19
- 389
- 0
Báo cáo khoa học: " Bioinformatic evidence for a stem-loop structure 5''''-adjacent to the IGR-IRES and for an overlapping gene in the bee paralysis dicistroviruses" pptx
... interests The authors declare that they have no competing interests Authors' contributions AEF carried out the bioinformatic analysis and wrote the manuscript All authors edited and approved the final ... investigating the translation mechanism for the putative ORFX and how it relates to the IGR-IRES and the potential upstream hairpin structure Note: during the preparation of this manuscript, the ... initiated in the +1 frame at the IGR-IRES normal initiation site; 83 codons if initiated at the tandem AUG codons (which are present in SINV-1 and align with the tandem AUG codons in the bee paralysis...
- 8
- 258
- 0
Báo cáo y học: "The SLC2A9 non-synonymous Arg265His variant and gout; evidence for a population-specific effect on severit" docx
... Zealand (NZ) Māori, Pacific Island and Caucasian samples Methods Rs3733591 was genotyped across gout patients (n=229, 232 and 327, for NZ Māori, Pacific Island and Caucasian, respectively) and ... Lindsay, Maria Lobo, Karen Pui and Gabrielle Sexton are thanked for assistance in recruitment Mik Black is thanked for his assistance with statistical analysis The Framingham Heart Study and the ... 174 and 638, for Māori, Pacific Island and Caucasian, respectively) Further Caucasian sample sets consisting of 67 cases and 4712 controls, and 153 cases and 6969 controls were obtained from the...
- 25
- 266
- 0
Báo cáo sinh học: "Bactericidal activity of oxacillin and glycopeptides against Staphylococcus aureus in patients with endocarditis: Looking for a relationship between tolerance and outcome" doc
... patients AR and AG collected strains and performed on admission susceptibility tests AS and RP analysed the data GS and FB revised the manuscript All authors read and approved the final manuscript ... Aerobically; Approved Standard Clinical and Laboratory Standard Institute, Wayne, PA, 2009, M07 -A8 18 Clinical and Laboratory Standard Institute: Methods for Determining Bactericidal Activity of Antimicrobial ... Clinical and Laboratory Standard Institute, Wayne, PA; 2008 17 Clinical and Laboratory Standard Institute: Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically;...
- 7
- 356
- 0
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
... APAF and hence activates CASP9 leading to the caspase cascade resulting in apoptosis G2 arrest and DNA damage signaling could also activate BAX leading to mitochondria-mediated apoptosis On the ... in the ERK signal transduction cascade, another branch of the MAPK signaling pathway (Figure 6) All the aforementioned MAPK associated pathways are also top ranked in the LTNP group in other pairwise ... TCA cycle and other metabolic pathways including OXPHOS, carbohydrates, lipid, and amino acid metabolisms are also illustrated In the remaining three categories, butanoate and fatty acid metabolism...
- 21
- 376
- 0
Báo cáo y học: " Analysis of the replication of HIV-1 forced to use tRNAMet(i) supports a link between primer selection, translation and encapsidation" ppsx
... ggaaaatctctagcagtggtagcagaggatggttctgaaagcgaaagggaaac 3' Met(i) 5' gtttccctttcgctttcagaaccatcctctgctaccactgctagagattttcc 3' 5' ggaaaatctctagcagtggtagcagagggtggttctgaaagcgaaagggaaac 3' Met(i) AG ... aattTAATACGACTCACTATAGGcctcgttagcgcagtagg 3' and 5' tgccccgtgtgaggatcgaactcacg accttcagattatgagactgacgcgctacctactgcgctaacgagg (tRNAMet(e)); 5' aattTAATACGACTCACTATAGGagcagagtggcgcagcgg 3' and 5' tagcagaggatggtttcgatccatcg ... sequence for T7 promoter: 5'aattTAATACGACTCACTATAGGcccggatagctcagtcgg 3' and 5'cgcccgaacagggacttgaaccctgg accctcagattaaaagtctgatgctctaccgactgagctatccgggc 3' (tRNALys,3); 5' aattTAATACGACTCACTATAGGcctcgttagcgcagtagg...
- 14
- 189
- 0
Báo cáo y học: " Degeneracy: a link between evolvability, robustness and complexity in biological systems" docx
... organizations Although a rigorous analysis of robustness and evolvability has not been attempted within any of these domains, there is anecdotal evidence that evolvability does not always go hand in hand ... against variations of a very specific type (’more of the same’ variations) For example, redundant parts can substitute for others that malfunction or fail, or augment output when demand for a ... components/processes that are integrated with the rest of the system and add to the complexity of the organizational form All complex life forms have evolved through a succession of incremental changes and are...
- 17
- 361
- 0
Báo cáo y học: " Mechanical ventilation in the ICU- is there a gap between the time available and time used for nurse-led weaning?" pot
... used for weaning and time available for weaning and 2) to analyse the patient and systemic factors were associated with the time available for weaning that is actually used for weaning To the best ... collected data from the ICU quality assurance database as well as ICU patient charts The Norwegian Social Science Data Services approved (no 11438) the data collection and storage of data The Regional ... and systemic factors associated with the time available for weaning that was actually Table 2: The relationship between weaning prescribed and weaning being performed in the 572 available weaning...
- 8
- 338
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25