navigator create a client side validate event called confirm changes for the cus rmc re

Tài liệu Java 3D is a client−side Java application programming interface (API) developed pdf

Tài liệu Java 3D is a client−side Java application programming interface (API) developed pdf

Ngày tải lên : 12/12/2013, 11:15
... of a JPanel that provides a Graphics object for its client area and receives the frames of the rendered scene The RenderingSurface extends AnimatingSurface, which creates a rendering thread, and ... Java They range from free to expensive, and have a wide variety of features Some of the more popular IDEs for Java development are: • Kawa, Allaire (http://www.allaire.com/) All the examples for ... */ public BranchGroup createSceneGraph() { // create a parent BranchGroup node for the Sphere BranchGroup bg = new BranchGroup(); // create an Appearance for the Sphere // The Appearance object...
  • 352
  • 389
  • 0
Tài liệu Create a Point-and-Click SQL Server Query Tool for Users Using a Windows Form doc

Tài liệu Create a Point-and-Click SQL Server Query Tool for Users Using a Windows Form doc

Ngày tải lên : 26/01/2014, 11:20
... passed to a DataAdapter control, filling a data table The data is then displayed when the data source of the DataGrid control is set to the data table Comments You can enhance this tool in a ... Take the txtSQLString text and create a data table; then set the ' data source of the data grid odaDisplay = New OleDb.OleDbDataAdapter(Me.txtSQLString.Text, mcnn) odaDisplay.Fill(dtDisplay) ... see a comparison to the literal "TABLE." The reason for this is that the fourth column returned is the same table type as the current table The other two types are SYSTEMTABLE and VIEW To see the...
  • 9
  • 490
  • 0
 Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)

Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)

Ngày tải lên : 03/11/2012, 10:58
... that each patient was already scheduled for the reference coronary angiography for any indication Coronary angiographic data was recorded digitally and on cine angiographic film and was sent back ... measured by the MCG device The resulting mathematically integrated patterns of the abnormal indexes are then compared for their degree of abnormality to the abnormal index patterns in the reference ... identical copy of the data was saved on the site MCG machine for post-study verification purposes before the data analysis was carried out The quality of the tracing was visually rechecked and graded...
  • 13
  • 684
  • 0
Tài liệu Understanding Potential Changes to the Veterans Equitable Resource Allocation (VERA) System - A Regression-Based Approach ppt

Tài liệu Understanding Potential Changes to the Veterans Equitable Resource Allocation (VERA) System - A Regression-Based Approach ppt

Ngày tải lên : 17/02/2014, 11:20
... condition These data were taken from the VA’s Capital Asset Baseline Assessment Also included in the equations are several variables aimed at measuring medical education and research activity related ... actual value and what the network would receive when the variable is set to the national average value (the unadjusted average allocation) For example, consider the analysis for the health status ... express our appreciation to Stephen Kendall and Robert McNamara of the VHA’s Allocation Resource Center for fulfilling our data requests and adding analytical insights along the way Thanks are also...
  • 136
  • 411
  • 0
Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf

Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf

Ngày tải lên : 24/03/2014, 03:20
... are defined similarly Average precision is the average of literal and nonliteral precision; similarly for average recall For overall performance, we take the f-score of average precision and average ... that neither the raw data nor the collected feedback sets are manually annotated for training purposes Since, in addition, the feedback sets are collected automatically, they are very noisy For ... in the field of nonliteral language processing, but also as training data for other statistical NLP tasks References Srinivas Bangalore and Aravind K Joshi 1999 Supertagging: an approach to almost...
  • 8
  • 447
  • 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

Ngày tải lên : 21/06/2014, 01:20
... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... Package for Social Sciences (SPSS) software A p value above 0.05 was considered that there was no significant difference between the two methods The as-prepared quantum dots are red solution According ... separation and diagnosis, the superparamagnetic nanoparticle has a unique advantage over others Herein, we report a novel detection method of HPV DNA combining the advantages of QDs and manipulability...
  • 9
  • 469
  • 0
báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx

báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx

Ngày tải lên : 21/06/2014, 20:20
... placed many important items at risk This has created an urgent need for a technique that can capture the information in each of the negatives of a large collection before the damage causes a ... state, meaning that conservation can continue and no changes are made that are irreversible If the results from a digital approach are not acceptable, the more challenging and expensive physical ... system As the distance from the camera’s optical center increases, the angle of incidence on the surface also increases This creates a systematic shift across the normal map that increases toward the...
  • 13
  • 569
  • 0
Báo cáo hóa học: "Research Article Harnack Inequality for the Schrödinger Problem Relative to Strongly Local Riemannian p-Homogeneous Forms with a Potential in the Kato Class" potx

Báo cáo hóa học: "Research Article Harnack Inequality for the Schrödinger Problem Relative to Strongly Local Riemannian p-Homogeneous Forms with a Potential in the Kato Class" potx

Ngày tải lên : 22/06/2014, 22:20
... Milano, Piazza Leonardo Da Vinci 32, Italy; Accademia Nazionale delle Scienze detta dei XL, Via L Spallanzani 7, Italy Email address: marbir@mate.polimi.it Silvana Marchi: Dipartimento di Matematica, ... Riemannian p-homogeneous forms; we define a suitable notion of Kato class of measures We assume that the potential is a measure in the Kato class and we prove a Harnack inequality (on balls that are ... subelliptic Laplacian were defined in [3], and the case of (bilinear) Riemannian Dirichlet form was considered in [4, 17] In [7] the Kato class was defined in the case of subelliptic p-Laplacian and in...
  • 19
  • 326
  • 0
Báo cáo toán học: " A Macdonald Vertex Operator and Standard Tableaux Statistics for the Two-Column (q, t)-Kostka Coefficients" doc

Báo cáo toán học: " A Macdonald Vertex Operator and Standard Tableaux Statistics for the Two-Column (q, t)-Kostka Coefficients" doc

Ngày tải lên : 07/08/2014, 06:22
... definitions in the previous section The ’atoms’ of the Macdonald polynomials and the µ − type of the standard tableaux suggest that the tableaux naturally fall into standard tableaux classes a For a sequence ... (21 where ωT is the tableau that is flipped about the diagonal Each standard tableau has either the label of lying to the immediate right of or above it A tableau that has a that lies immediately ... charge, the index of every letter (except the 1) of the word of the tableau decreases by when the labels are decreased A tableau that has a label of lying above the can be transposed about the...
  • 46
  • 260
  • 0
Báo cáo lâm nghiệp: "A survey of forest pollution with heavy metals in the Natural Forest Region (NFR) Moravskoslezské Beskydy with particular attention to Jablunkov Pass" docx

Báo cáo lâm nghiệp: "A survey of forest pollution with heavy metals in the Natural Forest Region (NFR) Moravskoslezské Beskydy with particular attention to Jablunkov Pass" docx

Ngày tải lên : 07/08/2014, 10:21
... Jablunkov Pass area The results can be used as the basis for the next treatment of affected stands METHODS Study site The NFR of Moravskoslezské Beskydy is a part of the outer Carpathian Arc The ... nonparametric correlations according to Spearman were calculated RESULTS As the industry centre is represented especially by heavy metallurgy, the main attention was paid to the concentration ... contents in these areas is higher than in any other NFR, and the level of Cr and Pb is also very high The results of more detailed analyses are presented in Tables and and discussed in the following...
  • 9
  • 379
  • 0
Báo cáo khoa học: " A comparison of mantle versus involved-field radiotherapy for Hodgkin''''s lymphoma: reduction in normal tissue dose and second cancer risk" docx

Báo cáo khoa học: " A comparison of mantle versus involved-field radiotherapy for Hodgkin''''s lymphoma: reduction in normal tissue dose and second cancer risk" docx

Ngày tải lên : 09/08/2014, 10:21
... detailed individual-level data on treatment In contrast, clinical trial datasets contain detailed information regarding initial treatment and may potentially facilitate detailed analyses of the ... participated in data analysis TTH, MH, NP participated in data collection All authors read and approved the final manuscript Additional material Additional file Calculation of Radiation-Induced Cancer Risks ... [5,7,8], three representative patients were selected for analysis These patients respectively had values for the mean female breast dose, mean female lung dose, and mean male lung dose that were closest...
  • 11
  • 369
  • 0
báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot

báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot

Ngày tải lên : 10/08/2014, 10:21
... our analysis the OS at years was 89%, at years 76% and at years 61% In another study conducted on patients with recurrent FL, treated with FCR, a 75% OS rate at years and a 61% PFS rate at years ... Y-RIT and disappeared with itraconazole treatment Other previous studies have already shown the low percentage of patients requiring hospitalization for infections [3,5] and a favorable safety ... myelodisplastic syndrome Acknowledgements The authors thank Dr Diana Giannarelli of the Department of Oncology Regina Elena National Cancer Institute for statistical analysis Author details Department...
  • 5
  • 287
  • 0
báo cáo khoa học: "Transient myeloproliferative disorder in a newborn with Down Syndrome treated with rasburicase for the risk of development of tumor lysis syndrome: A case report" doc

báo cáo khoa học: "Transient myeloproliferative disorder in a newborn with Down Syndrome treated with rasburicase for the risk of development of tumor lysis syndrome: A case report" doc

Ngày tải lên : 10/08/2014, 23:20
... hematological disease and was responsible for our patient’s treatment and care EH was responsible for our patient’s treatment and follow-up MH analyzed and interpreted the data from our patient ... patient regarding the immunophenotype of the hematological disease FA analyzed and interpreted the data from our patient regarding hematological disease, and was responsible for our patient’s treatment ... treatment and care as well as for the writing and revision of the manuscript All authors contributed equally to the final draft of the manuscript, and read and approved the final manuscript Submit...
  • 3
  • 316
  • 0
Báo cáo y học: " Lack of replication of genetic predictors for the rheumatoid arthritis response to anti-TNF treatments: a prospective case-only study" potx

Báo cáo y học: " Lack of replication of genetic predictors for the rheumatoid arthritis response to anti-TNF treatments: a prospective case-only study" potx

Ngày tải lên : 12/08/2014, 12:20
... with the Student t test for data available as mean and standard deviation and with the chi-square test for contingency tables for frequency data Analyses of the relationship between SNPs and treatment ... participated in the statistical analysis and in the interpretation of results JJGR coordinated the acquisition of clinical data and participated in the analysis and interpretation of results AG ... software [14,15] Estimation of the statistical power for the linear regression analysis was done by transforming the reported P values and the number of samples in the corresponding Suarez-Gestal...
  • 6
  • 280
  • 0
Báo cáo y học: "A mathematical model for the adenylosuccinate synthetase reaction involved in purine biosynthesis" pot

Báo cáo y học: "A mathematical model for the adenylosuccinate synthetase reaction involved in purine biosynthesis" pot

Ngày tải lên : 13/08/2014, 16:21
... http://www.tbiomed.com/content/4/1/11 Relationships between the reaction rate and the ASP concentration in the presence/absence of ASUC Figure Relationships between the reaction rate and the ASP concentration in the presence/absence ... source works were different The adequacy of the model was ensured by comparing the theoretical calculations and the experimental data from the literature sources that were not used while the fitting ... appears as though magnesium ions might act on the enzyme via their own independent centers This hypothetical mechanism therefore deserves to be called an "apparent molecular mechanism" by analogy...
  • 11
  • 311
  • 0
Báo cáo y học: "A unified framework of immunological and epidemiological dynamics for the spread of viral infections in a simple network-based population" ppt

Báo cáo y học: "A unified framework of immunological and epidemiological dynamics for the spread of viral infections in a simple network-based population" ppt

Ngày tải lên : 13/08/2014, 16:21
... outbreak (A and B) A comparison between the immune responsiveness and the overall behaviour of an outbreak (A) , as well as the overall severity an outbreak (B), as measured by the mean and accumulated ... (black and red lines) occurs Figure after (A) and accumulated (B) viral Mean100 Monte Carlo realizations loads in the population Mean (A) and accumulated (B) viral loads in the population after ... Figure tion-wide in parameter values and Variations accumulated viral load their effect on the populaVariations in parameter values and their effect on the population-wide accumulated viral load...
  • 13
  • 334
  • 0
head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 2 ppsx

head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 2 ppsx

Ngày tải lên : 14/08/2014, 20:21
... necessarily the same as your app type For example, a Productivity App can be written as a View-based Application, a Window-based Application, Navigation-based Application, or a Tab Bar Application Start ... or remembering pa URLs Q: Do I really need to care about usability and aesthetics so much? A: Usability and aesthetics are what made the iPhone a success, and Apple will defend them to the death ... that makes the views work This code is almost always written in Objective-C using Xcode and any other resources, all packaged into your application Pictures Data Images and other data are referenced...
  • 54
  • 365
  • 0
head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 3 potx

head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 3 potx

Ngày tải lên : 14/08/2014, 20:21
... can automatically release references, too In addition to retain and release, Objective-C has the concept of an autorelease pool This is basically an array of objects that the runtime will call ... has a retain count of because of the alloc, but is now in the autorelease pool, meaning it will be sent a release automatically after the current event loop has completed This will have a retain ... back to because an array will send a release to all of its items when the array is destroyed [newArray release]; “sixth” starts out with an autoreleased retain count of from the initial creation...
  • 54
  • 463
  • 0
head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 4 doc

head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 4 doc

Ngày tải lên : 14/08/2014, 20:21
... Datasource Miami Vice any for If there aren’tasource reuse, the dat one and creates a new t sets its conten bleview The tsa the new take nd scrolls cell a it in Captain you are here 4  143 sharpen ... NSMutableArray and NSArray can be initialized with values when you create them We re using an NSMutableArray because we re going to manipulate the contents of this array later We’ll get there in a minute ... information into an array To add the drink details to this version, we need a different data model Which options below are possible ways to load the drink data? Create a database with drink information...
  • 54
  • 399
  • 0