na h exchanger isoform 3 by protein kinase a in the renal proximal tubule
Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt
Ngày tải lên :
18/02/2014, 11:20
... to the polar head of the phospholipids and that this is followed by an interaction between the apolar acyl chains of the phospholipids and side chains of particular amino acids, thus accounting ... A possible explanation for this apparent discrepancy could be that PKA phosphorylation induces a conformational change that increases the accessible hydrophobic surface area, enabling freer access ... hormone-sensitive lipase C Krintel et al recombinant rat HSL, but are in accordance with the published activity of His-tagged human HSL [11,14] HSL inhibition by bis-ANS To evaluate whether bis-ANS had an effect...
- 11
- 562
- 0
Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf
Ngày tải lên :
18/02/2014, 16:20
... P-450 induced by 3- methylcholanthrene J Biol Chem 2 63, 575–580 Robin MA, Prabu SK, Raza H, Anandatheerthavarada HK & Avadhani NG (20 03) Phosphorylation enhances mitochondrial targeting of GSTA4-4 ... erythromycin, was preincubated for The reaction was initiated by the addition of mm NADPH, and continued for 30 at 37 °C in a shaking water bath The reaction was terminated by the addition of 250 ... 50% of the mitochondrial-associated proteins lack the canonical mitochondria-targeting signals, and the precise mechanisms by which these proteins are translocated to the mitochondrial compartment...
- 16
- 650
- 0
Báo cáo khoa học: Inhibition of the NF-jB transcriptional activity by protein kinase A pot
Ngày tải lên :
08/03/2014, 10:20
... p65 [ 23] Thus we have examined whether the phosphorylation of p65 at Ser276 is involved in the mechanism by which PKA inhibits NF-jB activation In Fig 4B, we examined the transcriptional activity ... Sugita, T & Toriumi, W (1999) IkappaB kinases phosphorylate NF-kappaB p65 subunit on serine 536 in the transactivation domain J Biol Chem 274, 30 3 53 30 356 33 Wang, D & Baldwin, A. S Jr (1998) Activation ... we have observed reproducibly that the cAMP/ PKA signaling pathway inhibits transcriptional activity of NF-jB Although a previous report by others [22] suggested that PKA inhibited NF-jB activation...
- 7
- 296
- 0
Báo cáo Y học: The Emery–Dreifuss muscular dystrophy associated-protein emerin is phosphorylated on serine 49 by protein kinase A pptx
Ngày tải lên :
17/03/2014, 17:20
... describing the isolation of a large protein complex consisting of PKA, the A -kinase anchoring protein AKAP149, protein phosphatase 1, nuclear lamins, emerin and actin from both differentiating myoblasts ... fusion protein was then incubated with protein kinase A and [32 P]ATP[cP] as described above To rule out autophosphorylation, each fusion protein was incubated with [32 P]ATP[cP] in the absence of protein ... partly, through its interaction with lamin A ⁄ C The nucleoplasmic domain of emerin and the equivalent domains of two other inner nuclear membrane proteins termed MAN1 and the lamina-associated...
- 14
- 418
- 0
Báo cáo khoa học: " Expression of tyrosine kinase A in the cerebral cortex of postnatal developing rat" docx
Ngày tải lên :
07/08/2014, 18:21
... evitcaeronummi erew V dna III ,II ,I reyal ,6DP dna 3DP tA eanimal ralunargarpus eht otni dehcnarb dna xepa sti morf esora taht ssecorp decnuonorp a dah snoruen ralugnairt egraL snoruen ladimaryp ... ytivitca lacitroc fo srepeeketag eht era yeht esuaceb tnatropmi ylralucitrap era snoruen V reyal ehT eanimal rehto eht ni naht ssel hcum saw IV dna VI reyal ni sllec delebal fo rebmun eht dna V reyal ... .cificeps saw ydobitna AkrT-itna hcae htiw gnilebal eht ,eroferehT detanimile erew seidobitna yradnoces dna yramirp eht htob ro ,yradnoces ,yramirp eht hcihw ni snoitaraperp ni deniatbo saw gnilebal...
- 5
- 298
- 0
Báo cáo Y học: Properties of the Na+/H+ exchanger protein Detergent-resistant aggregation and membrane microdistribution potx
Ngày tải lên :
08/03/2014, 16:20
... of Na+ /H+ exchanger present in the supernatant and the pellet [19], it was found that over 80% of the Na+ /H+ exchanger remained in the Triton X-100 insoluble fraction The Na+ /H+ exchanger has ... residues in the Na+ /H+ exchanger Arch Biochem Biophys 35 8, 116–124 10 Moor, A. N & Fliegel, L (1999) Protein kinase mediated regulation of the Na+ /H+ exchanger in the rat myocardium by MAPkinase-dependent ... activity and was not inhibitory We have recently shown that the Na+ /H+ exchanger is regulated by MEK-dependent (mitogenactivated protein kinase/ extracellular signal-regulated kinase kinase-dependent)...
- 9
- 433
- 0
Regulation of na+ h+ exchanger 1 (NHE 1) gene expression by mild oxidative stress
Ngày tải lên :
14/09/2015, 08:50
... (Reshkin et al., 2000b) Moreover, a recent finding shows that the oncogenic protein nucleophosminanaplastic lymphoma kinase (NPM-ALK) induce an alkaline intracellular condition through the modulation ... of the intracellular milieu (Ahmad et al., 2004) Therefore, we can say that if the intracellular pH induced by H2 O2 decreases beyond a certain threshold, caspases and/or other death-related factors ... transmembrane domains, motifs for NADPH and FAD binding at the C-terminus, and conserved paired histidines that could ligate heme groups In DUOX proteins, there is an additional N-terminal transmembrane...
- 288
- 272
- 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
Ngày tải lên :
22/02/2014, 04:20
... production, indicating that TS activated a LPS-stimulated signal pathway (Fig 4) PKC is a key kinase in the LPSstimulated signal pathway [30 ,31 ] The findings that PKC inhibitors, not PKA inhibitors, inhibited ... aryl amine, and then the diazotiated product forms an azochromophore by coupling with naphthyl-ethylenediamine Absorbance was measured at 550 nm in a Shimadzu UV-1600 spectrophotometer, and nitrite ... although their antioxidative OH-moiety is masked We hypothesized that an amphiphilic characteristic of TS is important for its enhancing effect, because among the a- T derivatives examined only TS has...
- 6
- 494
- 0
Báo cáo khoa học: Modulation of the Arabidopsis KAT1 channel by an activator of protein kinase C in Xenopus laevis oocytes potx
Ngày tải lên :
22/03/2014, 21:21
... for the Ca2+-independent ABA-activated SnRK2.6 kinase [21] In addition, the SnRK2.6 kinase could phosphorylate T306 in an in vitro kinase assay This evidence suggests that multiple protein kinases ... ABR kinase has been shown to phosphorylate the C-terminal region of KAT1 [16] One of the 10 members of the SNF1-related protein kinase in A thaliana, SnRK2.6, is an ortholog of AAPK and shares ... Kishimoto A, Nishiyama K, Nakanishi H, Uratsuji Y, Nomura H, Takeyama Y & Nishizuka Y (1985) Studies on the phosphorylation of myelin basic protein by protein kinase C and adenosine 3 :5¢-monophosphatedependent...
- 11
- 531
- 0
Báo cáo khoa học: Downregulation of protease-activated receptor-1 in human lung fibroblasts is specifically mediated by the prostaglandin E2 receptor EP2 through cAMP elevation and protein kinase A pot
Ngày tải lên :
30/03/2014, 04:20
... cyclooxygenase pathway PGE2 is the major prostanoid synthesized by lung fibroblasts [11] It can also act on fibroblasts in a paracrine fashion after release from the adjacent epithelial layer [12] In addition ... PAR-1 in other cell lines expressing this receptor We used the human astrocytoma cell line 132 1N1 and the human alveolar epithelial cell line A5 49 In 132 1N1 cells, mithramycin A reduced the PAR-1 ... modulation of the translation rate or the rate of internalization and degradation of PAR-1 protein As we and others [15–17,26 ,33 ] have shown the role of cAMP in the suppression of fibroblast function...
- 11
- 338
- 0
Báo cáo y học: " Protein kinase A-dependent Neuronal Nitric Oxide Synthase Activation Mediates the Enhancement of Baroreflex Response by Adrenomedullin in the Nucleus Tractus Solitarii of Rats" pps
Ngày tải lên :
10/08/2014, 05:21
... designed and coordinated the experiments, and drafted the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests ... whether the nNOS-dependent mechanism contributes to the BRRenhancing effect of ADM in NTS remains unclear Page of The present study was undertaken to evaluate the hypothesis that ADM may enhance ... further found that the BRR enhancement induced by 8-Br-cAMP was completely blocked by L-NAME (Figure 5B) On the other hand, the BRR-enhancing effect of SIN-1 was not altered by the PKA inhibitor...
- 9
- 633
- 0
Regulation of na+ h+ exchanger 1 (NHE1) stability in PTEN mouse embryonic fibroblasts
Ngày tải lên :
10/09/2015, 09:29
... repeat protein phosphatase PIP2 Phosphatidylinositol -3, 4-bisphosphate PIP3 Phosphatidylinositol -3, 4,5-trisphosphate PI3K PI3 -Kinase PP 2A Protein phosphatase 2A PTEN Phosphatase and Tensin Homolog ... homologous protein Carbonic anhydrase II Heat shock protein 70 Death-domain-associated protein Protein tyrosine phosphatase Raf kinase β- Arrestin-1 Phosphofructokinase Protein phosphatase RSK ERK ... Interacting Protein ERM AKT ROCK PIP2 ERM family proteins Protein kinase B RhoA kinase Phosphatidylinositol 4,5bisphosphate Ribosomal S6 kinase Extracellular signalregulated kinase Nck-interacting...
- 214
- 258
- 0
Reactive oxygen species mediated regulation of the na+ h+ exchanger, NHE 1 gene expression a new mechanism for tumor cells resistance to apoptotic cell death
Ngày tải lên :
16/09/2015, 08:31
... I.5 Na+ -H+ Exchanger (NHE) The Na+ -H+ exchangers (NHEs) are a family of membrane glycoproteins which transport H+ out of the cell in exchange for Na+ with a stoichiometry of 1:1 In mammalian cells, ... re-perfusion Increased Na+ that gets accumulated in the cell activates the Na+ /Ca++ exchanger Na+ then leaks out of the cell in exchange for Ca++ ions Increased concentration of Ca++ ions in the myocardium ... an influx of Na+ and HCO3- to an efflux of Cl- and H+ (so that NaHCO3 comes in and HCl goes out) A Na+ -independent Cl HCO 3exchanger also has an important role in pHi regulation Like the Na+ -dependent...
- 155
- 399
- 0
Insights into protein kinase a activation using cAMP analogs and amide h 2h exchange mass spectrometry
Ngày tải lên :
16/10/2015, 15:36
... with the guanidinium side chain of the invariant Arg209 in the PBC of RIα (91-244) The Arg209 contacts the side chain carboxylate group of Asp170 and transmits the signal of cAMP binding This interaction ... with Arg209, which further contacts the carboxylate of Asp170,present at the amino terminus of the 3 sheet This Asp residue further relays the signal to Arg226 at the N-terminal of α-C sheet facilitating ... One of the keys to this mechanism would be in obtaining additional information about the intermediate state in the activation of PKA from the inactive holoenzyme state to the dissociated catalytic...
- 0
- 164
- 0
Tài liệu Báo cáo khoa học: Protein kinase CK2 activates the atypical Rio1p kinase and promotes its cell-cycle phase-dependent degradation in yeast pdf
Ngày tải lên :
18/02/2014, 16:20
... cells: the number of metaphase cells with a single DNA mass at the bud neck and the number of anaphase cells were increased slightly in the mutant (metaphase cells: 30 .2% in the mutant versus 24% in ... that fail to become phosphorylated, mainly have difficulties entering the S phase The reason for the accumulation of cells in the G1 phase may be due to the slightly lower kinase activity of the ... Na3 VO4, mm phenylmethylsulfonyl fluoride, lgÆmL)1 each aprotinin, leupeptin and pepstatin, twice in kinase buffer, and used for in vitro kinase assays In vitro kinase assays Recombinant human protein...
- 14
- 553
- 0
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx
Ngày tải lên :
19/02/2014, 18:20
... to the cDNA The purified cDNA was used as substrate in PCR with the following Ras-GRF1 gene-specific primers: ON357, 5¢-TGAAACATCACCAACTAAATC TCCAA -3 ; ON358, 5¢-GACGACTCCATTGTTATAGG AAAAGAGT -3 ; ... with cDNA encoding the human 140 kDa Ras-GRF1 (data not shown) Taken together, these mRNA and protein data demonstrate that the full-length 140 kDa Ras-GRF1 protein is endogenously expressed in ... MR & Macara IG (1994) Muscarinic receptors transform NIH 3T3 cells through a Ras-dependent signalling pathway inhibited by the Ras-GTPase-activating protein SH3 domain Mol Cell Biol 14, 79 43 7952...
- 13
- 730
- 0
Báo cáo khoa học: The natural mutation by deletion of Lys9 in the thrombin A-chain affects the pKa value of catalytic residues, the overall enzyme’s stability and conformational transitions linked to Na+ binding pdf
Ngày tải lên :
07/03/2014, 12:20
... Stabilization within the A- chain and between the A- and B-chains occurs mainly through salt bridges and H bonds involving charged side chains The A- chain is intramolecularly cross-linked by five ... in the A- chain of thrombin [1,2] Measurements of the pH dependence of both steady-state amidase activity and binding of the high-affinity inhibitor a- NAPAP showed pKa values of the catalytic His57 ... higher the flexibility of the A- chain the higher the number of electrostatic ⁄ H- bonding contacts between the A- and B-chain in the WT thrombin, in agreement with slower release of the light chain...
- 11
- 553
- 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
Ngày tải lên :
07/03/2014, 15:20
... 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC -3 and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG -3 YEp351-SUT2 was constructed to contain SUT2 as the ... yeast/info/tools/hegemann/gfp.html) using the primers SUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC -3 and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAACAGCTATGACCATGATTACGCTATAGG GCGAATTGGGTA -3 , ... TAATATTCCTATATTTTACATAGGAGGAAATTA CATGCATGAAACCTACAGCTGAAGCTTCGTAC GC -3 , respectively The plasmid pFL38-RAS2 was constructed by ligating the kb HindIII/EcoRI-RAS2 fragment from plasmid YCplac22-RAS2...
- 8
- 485
- 0
Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc
Ngày tải lên :
08/03/2014, 22:20
... Parallel packing of the aromatic side chains Tyr16, Phe31, Tyr35 and Phe36 and contacts involving the side chains of Leu12, Val20, Leu28, Val29, Val 33, Thr37 and Leu39, are observed in the hydrophobic ... Biochem 269) against each other and they are clearly independent from the protein hydrophobic core The exposed hydrophobic groove is the binding site of the amphipathic AKAP peptides through their ... with other parts of the regulatory subunit and the catalytic subunit are currently in progress, with the hope that they might shed light into the importance of the intriguing, highly charged, face...
- 12
- 536
- 0
Báo cáo khoa học: Regulation of luteinizing hormone receptor mRNA expression by mevalonate kinase – role of the catalytic center in mRNA recognition potx
Ngày tải lên :
16/03/2014, 06:20
... homoserine kinase mevalonate kinase phosphomevalonate kinase (GHMP) kinase superfamily of enzymes that are known to have a left-handed b a b fold, which is found in other RNA ⁄ DNA binding proteins ... for LHR mRNA binding and for its role as a translational suppressor of LHR mRNA The results showed a substantial decrease in LHR mRNA binding activity when any of the amino acids at the active ... indicating that these amino acids are also essential for LHR mRNA binding This was further confirmed by RNA gel shift analysis, with double mutants of MVK proteins showing decreased LHR mRNA binding...
- 11
- 367
- 0