move your mouse over a field that is ticked in the field list section

Báo cáo toán học: "The crossing number of a projective graph is quadratic in the face–width" doc

Báo cáo toán học: "The crossing number of a projective graph is quadratic in the face–width" doc

Ngày tải lên : 07/08/2014, 15:23
... graph that embeds in Σg , that is, |C0 | ≤ (7 + + 48g) It is an easy observation that no four pairwise homotopic noncontractible curves (in any orientable surface) can pairwise intersect in exactly ... Suppose that G is a graph with maximum degree ∆ that embeds in the projective plane with face–width r Then the crossing number of G in the plane (and thus in any orientable surface) is at most ... graphs The basic idea behind our approximation algorithm is that the crossing number of bounded degree projective graphs is bounded by above and by below by quantities that are within a constant factor...
  • 8
  • 336
  • 0
Báo cáo Y học: A nonphosphorylated 14-3-3 binding motif on exoenzyme S that is functional in vivo pot

Báo cáo Y học: A nonphosphorylated 14-3-3 binding motif on exoenzyme S that is functional in vivo pot

Ngày tải lên : 31/03/2014, 08:20
... to the appearance of multiple negatively charged amino acids (Table and [24]) Another 14-3-3 binding protein is GPIb -a, which contains a reported interaction domain [30] This domain harbours the ... expresses and translocates ExoS protein with high efficiency, at levels greater than that observed in strains such as P aeruginosa 388 and PAK For this reason we have engineered a Yersinia strain to ... 14-3-3 antisera specific for the seven isoforms (b, f, s, r, e, g and c) using a BiometraTM slot blot apparatus A summary of these antisera is shown in Table and [41] (A) Whole HeLa cell lysate HeLa...
  • 9
  • 394
  • 0
báo cáo khoa học: "A nanocomplex that is both tumor cell-selective and cancer gene-specific for anaplastic large cell lymphoma" ppt

báo cáo khoa học: "A nanocomplex that is both tumor cell-selective and cancer gene-specific for anaplastic large cell lymphoma" ppt

Ngày tải lên : 11/08/2014, 00:22
... vitro and in vivo Tumori 2008, 94:539-550 Tabata T, Tsukamoto N, Fooladi AA, Yamanaka S, Furukawa T, Ishida M, Sato D, Gu Z, Nagase H, Egawa S, et al: RNA interference targeting against S10 0A4 suppresses ... selective binding of nanocomplexes to ALCL cells The aptamer-mediated binding A Aptamer Polyethyleneimine (PEI) Ap t Aame r RN Aptamer Sodium citrate + si PEI-citrate me r p A Aptananocore ta siRNA mer ... Recently, a RNA aptamer was developed that specifically binds to the CD30 protein in solution [30] In addition, we have shown that this RNA aptamer selectively binds to intact CD30-expressing lymphoma...
  • 12
  • 201
  • 0
Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx

Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx

Ngày tải lên : 20/02/2014, 01:20
... 5¢-AGGCCCCGGGTCACCTC CTAGCTAGAATTC-3¢ for a1 ; and 5¢-AGGTGATC ATATGCTTCTAGAGAAGAGTGAAATA-3¢ and 5¢-AG AGGATCCTCAGCCCATTTGGAGGGCGG-3¢ for b1 In each case, the forward primer introduced a unique NdeI ... kDa), catalase (232 kDa), aldolase (158 kDa), albumin (67 kDa) and ribonuclease A (13.7 kDa) serving as molecular standards (Amersham Bioscience) Analysis of the N-terminal amino-acid sequences The ... family have similar structures consisting of two domains, one that binds FMN and one that binds FAD and NADPH [8–10] The FMN domain is homologous to flavodoxins, while the FAD and NADPH domain is homologous...
  • 11
  • 549
  • 0
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx

Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx

Ngày tải lên : 07/03/2014, 05:20
... S1) In addition, the ORF contains two arginine ⁄ glycine-rich (RGG) motifs that are characteristic of RNA-binding proteins, and an alanine-rich carboxy-terminal sequence that could be involved in ... may mediate the enhancing effect of splicing on mRNA translation [34–36] Rbm9, as a splicing factor interacting with a PAP, may also participate in the translational enhancement mediated by introns ... Mammalian GLD–2 homologs are poly (A) polymerases Proc Natl Acad Sci USA 101, 4407–4412 Nakanishi T, Kubota H, Ishibashi N, Kumagai S, Watanabe H, Yamashita M, Kashiwabara S, Miyado K & Baba T (2006)...
  • 14
  • 502
  • 0
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx

Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx

Ngày tải lên : 23/03/2014, 13:20
... N-terminal kinase (JNK1) is rapidly activated in L-MAT cells, and that a dominant negative mutant of JNK prevented TCDD-induced cell death [7] Ghaffari-Tabrizi et al and others have demonstrated that ... explained by the single AhR pathway The molecular mechanism involved in the AhR-independent pathway(s) leading to TCDDinduced immunotoxicity is not clearly understood, and indeed the lack of a ... TCDD (as indicated) for h Finally, the effect of over- expression of DN-PKCh in L-MAT cells on TCDD-induced apoptosis was evaluated by assessing caspase-3 activation Data are shown as average values...
  • 13
  • 426
  • 0
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf

Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf

Ngày tải lên : 29/03/2014, 21:20
... CGCCATGGCAATGATGGTACTGAAAGTAGAGG CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG ... CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTACTGAGAG ... primer mC3.F ACAACAATCAGCTGGTTTTCACC mC3.P TGCCAAGCTCCATGGCTCCTATGAAG mC3.R CAAAAAACTCTGTCACCCCTCC mCARP.F CTTGAATCCACAGCCATCCA mCARP.P CATGTCGTGGAGGAAACGCAGATGTC mCARP.R TGGCACTGATTTTGGCTCCT...
  • 16
  • 462
  • 0
Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt

Báo cáo khoa học: Myocyte enhancer factor 2B is involved in the inducible expression of NOX1⁄ NADPH oxidase, a vascular superoxide-producing enzyme ppt

Ngày tải lên : 30/03/2014, 03:20
... Fan C, Katsuyama M, Nishinaka T & Yabe-Nishimura C (2005) Transactivation of the EGF receptor and a PI3 kinase-ATF-1 pathway is involved in the upregulation of NOX1, a catalytic subunit of NADPH ... MEF2-binding site (5¢-CTATAAATAG-3¢ to 5¢-CTATAgccAG-3¢) abolished PGF 2a- induced transcriptional activation A schematic diagram of the promoter-luciferase fusion plasmids is shown on the left, where the ... )146 and )125, a consensus sequence of the MEF2binding site, 5¢-CTA (A ⁄ T)4TAG ⁄ A- 3¢, was located (Fig 3A) The introduction of mutations at this site (5¢-CTATAAATAG-3¢ to 5¢-CTATAgccAG-3¢) abolished...
  • 9
  • 452
  • 0
Báo cáo khoa học: SLC39A14, a LZT protein, is induced in adipogenesis and transports zinc pptx

Báo cáo khoa học: SLC39A14, a LZT protein, is induced in adipogenesis and transports zinc pptx

Ngày tải lên : 30/03/2014, 16:20
... 5¢-CAATGCTGGCAT GAGCAT-3¢ or 5¢-CTTCTTGGGGAAACATG-3¢, and a reverse primer: 5¢-CCAGCATAATGGAGAAGC-3¢, 5¢-AA CTGGACCCTAAGCCTA-3¢ or 5¢-ACTGGATCCTAGGT GATC-3¢ 5¢-RACE was performed using a Marathon cDNA Amplification ... resultant double-stranded cDNA was ligated to a Marathon cDNA adapter by T4 DNA ligase The PCR for 5¢-RACE was performed using the forward primer AP-1: 5¢-CCATCCTAATACGACTCACTAT AGGGC-3¢ and a SLC3 9A1 4-specific ... SLC3 9A1 4 indicated that this gene has another crucial motif, a histidine-rich repeat, which is a potential metal binding motif [17,20,21] Therefore, we have established a stable SLC3 9A1 4-expressing...
  • 10
  • 323
  • 0
what is what in the nanoworld. a handbook on nanoscience and nanotechnology, 2004, p.350

what is what in the nanoworld. a handbook on nanoscience and nanotechnology, 2004, p.350

Ngày tải lên : 04/06/2014, 14:50
... is the interatomic distance, A and a are the empirical parameters depending on the charge of the nucleus, XIand ;52 are the atomic numbers of the interacting atoms Born-Mayer-Huggins potential ... empirical parameters, ql and 92 are formal charges of the atoms Horn-Mayer potential - the interatomic pair potential in the form: where r is the interatomic distance, A and (I are the empirical parameters ... axis, for instance the z-axis, but the same magnitude of momentum becauve I is the samc for all three In this case the orbital with m[ = O has zero angular momentum around the z-axis It has the...
  • 350
  • 337
  • 0
what is what in the nanoworld. a handbook on nanoscience and nanotechnology, 2008, p.541

what is what in the nanoworld. a handbook on nanoscience and nanotechnology, 2008, p.541

Ngày tải lên : 04/06/2014, 15:18
... (mechanics) stating that friction is independent of the velocity, and the law of Leonardo da Vinci stating that friction is independent of the area of contact In particular, Leonardo da Vinci arrived ... mechanics are incompatible with any local hidden variables theory apparently satisfying only the natural assumptions of locality The inequality is violated if the joint state of two spins is a ... surface structure is obtained by maintaining the vibration amplitude at a constant level using the feedback circuit The loading force acting between the probe tip and the sample surface can be...
  • 541
  • 499
  • 0
báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf

báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf

Ngày tải lên : 18/06/2014, 15:20
... for single marker analysis Statistical significance was assumed at p < 0.05 Statistical power (1-β) was calculated using binominal power calculation The power calculation for the -173 SNP and the ... malarial anemia J Infect Dis 2009, 200:629-637 Dhanantwari P, Nadaraj S, Kenessey A, Chowdhury D, Al-Abed Y, Miller EJ, Ojamaa K: Macrophage migration inhibitory factor induces cardiomyocyte apoptosis ... analyzed separately as well as analyzed as a haplotype Especially in the sub group of patients ≤60 years old and in patients with non-abdominal and non-pulmonary sepsis focus the association with...
  • 8
  • 554
  • 0
Báo cáo khoa học: "Is there a place for N-acetylcysteine in the treatment of septic shock" pptx

Báo cáo khoa học: "Is there a place for N-acetylcysteine in the treatment of septic shock" pptx

Ngày tải lên : 12/08/2014, 20:20
... injury was decreased, however, and there was also a significant increase in the cardiac index in the NAC-treated group [20] Conclusions This is an exciting time for intensivists involved in the care ... microcirculation and thus oxygen extraction, while at the same time attenuating inflammatory responses Prostacyclin, a prostaglandin synthesized in endothelial cells, is a potent vasodilator and an inhibitor ... TNF-α and IL-6 and reduced the mortality rate in premature infants with sepsis [13] NAC in animal experimental and human sepsis NAC increases nitric oxide synthesis and cGMP Several studies have...
  • 3
  • 469
  • 0
Báo cáo y học: "APOBEC3G induces a hypermutation gradient: purifying selection at multiple steps during HIV-1 replication results in levels of G-to-A mutations that are high in DNA, intermediate in cellular viral RNA, and low in virion RNA" pps

Báo cáo y học: "APOBEC3G induces a hypermutation gradient: purifying selection at multiple steps during HIV-1 replication results in levels of G-to-A mutations that are high in DNA, intermediate in cellular viral RNA, and low in virion RNA" pps

Ngày tải lên : 13/08/2014, 05:21
... Vif was amplified using the forward primer YRHHYmutF, 5'GGAAAGCTAAGGACTGGT TTGCTGCAGCTGCCGCTGAAAGTACTAATCCAAAAATA AG3', and the reverse primer VifR, 5'GGATAAACAGCAGT TGTTGC3' The resulting amplicons ... indicated that purifying selection pressure was operating against genomes that had inactivating mutations in the gag gene The observation that a few of the viral RNA-derived sequences had inactivating ... proviral DNA, cRNA, and vRNA across each individual infection (YA, YB and YC) for Rounds and was determined Statistical significance was calculated using the t-test assuming equal variance with a...
  • 15
  • 320
  • 0
Báo cáo y học: " Indications that "codon boundaries" are physico-chemically defined and that protein-folding information is contained in the redundant exon bases" pot

Báo cáo y học: " Indications that "codon boundaries" are physico-chemically defined and that protein-folding information is contained in the redundant exon bases" pot

Ngày tải lên : 13/08/2014, 23:20
... black dots in the RCMs indicate amino acids that are within 6Å of each other in the protein structure The colored (grasslike) areas in the EDPs indicate the energetically most likely RNA interactions ... representations The black dots in the RCMs indicate amino acids that are within 6Å of each other in the protein structure The colored (grass-like) areas in the EDPs indicate the energetically mostly ... divided into 20 subgroups corresponding to 20 amino acids (one of the co-locating pairs), each group containing 20 amino acids (corresponding to the other amino acids in each co-locating pair) If the...
  • 11
  • 327
  • 0
Báo cáo y học: "Soluble triggering receptor on myeloid cells-1 is expressed in the course of non-infectious inflammation after traumatic lung contusion: a prospective cohort study" pptx

Báo cáo y học: "Soluble triggering receptor on myeloid cells-1 is expressed in the course of non-infectious inflammation after traumatic lung contusion: a prospective cohort study" pptx

Ngày tải lên : 14/08/2014, 08:21
... tissue macrophages [9] The resulting self-propagating inflammation within the alveolar space might cause devastating lung injury and is associated with a significant mortality Given the role ... details Clinic of Anaesthesiology, Intensive Care Medicine and Pain Therapy, University Hospital Frankfurt am Main, Theodor Stern Kai 7, 60590 Frankfurt am Main, Germany 2Department of Trauma, ... cells-1 in bacterial infection: a meta-analysis Intensive Care Med 2009, 35:587-595 Porfyridis I, Plachouras D, Karagianni V, Kotanidou A, Papiris SA, Giamarellou H, Giamarellos-Bourboulis EJ: Diagnostic...
  • 7
  • 455
  • 0
Domestic Wastewater Reclamation Coupled with Biofuel/Biomass Production Based on Microalgae: A Novel Wastewater Treatment Process in the Future

Domestic Wastewater Reclamation Coupled with Biofuel/Biomass Production Based on Microalgae: A Novel Wastewater Treatment Process in the Future

Ngày tải lên : 05/09/2013, 10:17
... pollutants in wastewater, large amount of excess sludge is generated during the assimilation of organics by microorganisms in the activated sludge Therefore, the wastes are transferred from liquid phase ... an approach of CO2 fixation In the microalgal cultivation system the microalgae grow with inorganic nutrients in wastewater as growth medium, and at the same time the nitrogen and phosphorus in ... wastewater are removed efficiently After the microalgal cultivation system, the microalgal cells need to be separated and harvested from the wastewater According to the property of microalgal...
  • 9
  • 762
  • 0
Hoc T.a qua bai hat (fill in the blanks)

Hoc T.a qua bai hat (fill in the blanks)

Ngày tải lên : 15/09/2013, 07:10
... cross the stream, I have a dream I have a dream, a fantasy To help me ………………… reality And my destination ……………… it worth while Pushing through the darkness, still another mile * * I have a dream, ... like this I just wanna …………… you know that everything that I hold in 'Cause ……………… that I can't let go (can't let go, yeah) * Don't you know it baby I don't want to ………… another day I wish that I ... once again Over seas from coast to ………………… To find the place I love the most, ………………… the fields are green, to see you once again, my love 17 Only love – Trade Marks Two a. m and the rain is ………………...
  • 3
  • 655
  • 1
Executing Commands that Modify Information in the Database

Executing Commands that Modify Information in the Database

Ngày tải lên : 24/10/2013, 08:15
... DisplayRow() that retrieves and displays the details of a specified row from the Customers table DisplayRow() is used in the program to show the result of the INSERT and UPDATE statements Listing ... returned is the number of rows added to the Customers table, which is since one row was added by the INSERT statement Let's take a look at an example that executes an UPDATE statement to modify the ... property of the Command object to the CREATE TABLE statement The following example sets the CommandText property of mySqlCommand to a CREATE TABLE statement that creates a table named MyPersons...
  • 8
  • 294
  • 0
A study on modal adjuncts in the mental process in english and vietnamese newspapers

A study on modal adjuncts in the mental process in english and vietnamese newspapers

Ngày tải lên : 26/11/2013, 13:17
... should feel satisfied at gaining a draw having trailed by a goal and a man against Barcelona He didn't say this but he probably also felt that inferences would once again be drawn about Qatar's methods ... Vietnamese utterance: initial, medial and final in the MenP Most MAs in English and Vietnamese can assume the initial position as thematic mood adjuncts expressing probability, certainty and intensity ... comparing MAs in English with their counterparts in Vietnamese The analysis also looks into the contribution of each component into the shaping of the syntactics, semantics and pragmatics of MAs...
  • 13
  • 1K
  • 1