morphology change of an electrode consisting of sno2 nanoparticles a before and

Synthesis of metal oxide nanostructures and their applications as lithium ion battery anodes

... of nanoparticles completely loss its morphology and the electrode was disintegrated by many cracks. [49] 10 Figure 1-4: Morphology change of an electrode consisting of SnO2 nanoparticles (A) before ... stored Therefore, the capacity of a LIB is greatly dependent on the performance of the electrodes, namely cathode and anode For the current generation of LIB, the commercially available cathode and ... Figure 1-3: Changes of 18 650 LIB cells production over years.[9] Figure 1-4: Morphology change of an electrode consisting of SnO2 nanoparticles (A) before and (B) after the 50 cycles. [49] ...

188
1,022
0

Báo cáo khoa học: Identiﬁcation and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

Danh mục: Báo cáo khoa học

... synthetic oligonucleotides For EGT 5¢GATCCGCCACCATGACCATCTTATGTTGGCTCG CTCTCCTGAGCACACTCACAGCTGTTAACGCTG ACATCA-3¢ and Back EGT 5¢-GATCTGATGTCAGCG TTAACAGCTGTGAGTGTGCTCAGGAGAGCGAG CCAACATAAGATGGTCATGGTGGCG-3¢ ... sialyltransferase activity as described below Multiple tissue expression array and northern analysis An EcoRI–BamHI 1.6 kb fragment of the human ST6Gal II cDNA and a 1.8 kb human b- actin cDNA ... lobe, hippocampus, and fetal tissues (brain, kidney, thymus, liver), and rather weakly in placenta, lung, aorta, amygdala, occipital and parietal lobe and salivary gland Almost no expression was...

Báo cáo khoa học: "High grade B-cell gastric lymphoma with complete pathologic remission after eradication of helicobacter pylori infection: Report of a case and review of the literature" pdf

Danh mục: Báo cáo khoa học

... duration and weight loss (more than 10% of the body weight) Clinical examination was unremarkable and laboratory data were within normal values; only a mild hypochromic anemia was disclosed (Hb ... regression of lymphoma after chemotherapy [15,22] Because of the advanced age, additional chemotherapy was postponed in a patient; "wait and watch" follow-up was chosen for him [15] Page of (page number ... described a patient affected by DLBCL with areas of MALT lymphoma that responded to antimicrobial therapy After few months, Seymour et al., [12] reported the case of a 73 year-old woman with a DLBCL...

Báo cáo y học: " Identification of a novel linear B-cell epitope in the UL26 and UL26.5 proteins of Duck Enteritis Virus" doc

Danh mục: Báo cáo khoa học

... TGCAGGGATCCATGCAGTTAGATGGTGACAAT CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1540-1575 36 F7 TGCAGGGATCCATGTTAGATGGTGACAATATC CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1543-1575 33 F8 TGCAGGGATCCATGGATGGTGACAATATCTAT ... CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1552-1575 24 F11 TGCAGGGATCCATGAATATCTATTATCCGGGG CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1555-1575 21 F12 F13 TGCAGGGATCCATGATCTATTATCCGGGGGAA CTTTGGTCGACTTATTCCCCCGGATAATAGAT GATCCATGATCTATTATCCGGGGTAAG ... GTCGACTTACAGCTGCCCTCCCTGGAC 1042-1347 306 F2 GGATCCATGTATGGACAGCCTGTTTAT GTCGACTTAAGCTAATGGTCCAGTAGA 1294-1731 438 F3 GGATCCATGCCTACTGGACAAGGTAAC GTCGACTCAACATCTATTACACATCA 1681-2124 444 F2-1 GGATCCATGTATGGACAGCCTGTTTAT...

Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Danh mục: Báo cáo khoa học

... of other antibodies were as follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, ... separated by SDS/PAGE and BN/PAGE and transferred to Immobilon-P (0.2 l) membranes Anti-HA and anti-porin sera were used at : 500 0 dilution whereas the anti-MWFE and anti-18 kDa sera were used at ... domain between the peripheral-subcomplex k and the integral membrane-subcomplex b [2] The MWFE subunit is apparently unstable in the absence of any of the ND subunits (V79-G7), or in the absence...

Báo cáo "Series representation of random mappings and their extension " potx

Danh mục: Báo cáo khoa học

...

Báo cáo khoa học: Synthesis and characterization of a new and radiolabeled high-afﬁnity substrate for H+/peptide cotransporters pdf

Danh mục: Báo cáo khoa học

... sub5910 strates of H+ ⁄ peptide cotransporters, such as Gly-Sar, Ala-Ala, Lys-Lys, Ala-Asp, d-Phe-Ala, Ala-Ala-Ala, d-aminolevulinic acid, cefadroxil and Ala-4-nitroanilide (all 100 lm, Table ... h The amount of Bip-Pro in the extracellular uptake medium was quantiﬁed according to the laboratory standard HPLC (La-ChromÒ; Merck-Hitachi, Darmstadt, Germany) with a diode array detector and ... Germany) and collagenase A from Roche (Mannheim, Germany) Ala-4-nitroanilide and Lys(4-nitrobenzyloxycarbonyl)-Val were synthesized according to peptide synthesis standard procedures [18,29] All...

Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt

Danh mục: Báo cáo khoa học

... respective B- chains The active RNA N-glycosidase sites of abrin -a, abrin-c and ricin are composed of ve invariant residues (Tyr74, Tyr113, Glu164, Arg167 and Trp198 in abrin -a and abrin-c, and Tyr115, ... Arg215 and Trp246 in ricin) and another ve conserved residues (Asn72, Arg124, Gln160, Glu195 and Asn196 in abrin -a and abrin-c and Asn78, Arg134, Gln172, Glu208 and Asn209 in ricin) [30,35] The ... were analyzed using 15% SDS PAGE and were silver-stained Lane M, protein marker; numbered lanes correspond to incubation times rPAB heterodimer appears as an additional band of 60 kDa after...

Báo cáo khoa học: Engineering of a monomeric and low-glycosylated form of human butyrylcholinesterase pdf

Danh mục: Báo cáo khoa học

... displayed a single broad band in the 70±75 kDa molecular mass range In contrast, the puri®ed plasma BChE showed a faint band at 170 kDa (nonreducible dimer) and a major broad band at 85 kDa (monomer) ... Harel, M., Giles, K., Toker, L., Velan, B. , Lazar, A. , Kronman, C., Barak, D., Ariel, N., Shaerman, A. , Silman, I & Sussman, J.L (2000) Structures of recombinant native and E202Q mutant human ... glycerol (v/v) as a cryoprotectant, and synchrotron radiation at the ESRF ID14-eh2 beamline Analysis of the collected data (Table 3) indicated that BChE crystals belong to the tetragonal space group...

Báo cáo khoa học: Membrane targeting of a folded and cofactor-containing protein potx

Danh mục: Báo cáo khoa học

... analyses, the RRﬁKK exchange was achieved using the primers 5¢-CATCACTTTGACAGCGTCTTTCTTGCTC TTGCTGATTGGCTTATCG-3¢ and 5¢-CGATAAGCCA ATCAGCAAGAGCAAGAAAGACGCTGTCAAAGTG ATG-3¢ using the QuikChange ... Rea and Carsten Sanders for many valuable discussions and help This work was supported by grants DOE 91ER20052 and NIH GM38237 to F D and by grant BMBF-LPD 9901/8-14 from the German Academy of ... small amount of 55Fe could be associated with the membrane in the absence of ATP, and addition of ATP enhanced it by about 5- to 20-fold (Figs 4B and 5) From 55Fe label tracing 1216 T Bruser et al...

Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf

Danh mục: Báo cáo khoa học

... anaerobic conditions, decreases in absorbance at 400, 535 and 690 nm took place and broad bands appeared at 431 and 795 nm (Fig 4A, spectrum a) The absorption around 795 nm initially increased and ... to a decrease in absorbance (Fig 3A, panel) Spectrum b obtained with ﬁve equivalents of O2 still showed the absorption maxima characteristic of verdohaem but the absorbance was reduced over the ... forms of a- hydroxyhaem bound to HO-1 were ﬁrst investigated by Matera et al [26]; the optical spectrum of the ferric form exhibited a rather broad Soret band, whereas the Soret bands of the ferrous...

Pulmonary tuberculosis associated with increased number and percentage of natural killer and B cells in the peripheral blood pot

Danh mục: Sức khỏe giới tính

... 252-260 Vidyarani M, SelvarajP, Jawahar MS, Rajeswari ND, Anbalagan S, Narayanan PR (2007) Intracellular granzyme A expression of peripheral blood lymphocyte subsets in pulmonary tuberculosis ... a Becton Dickinson FACScalibur instrument CELLQUEST TM software (BD Bioscience, San Jose, CA, USA) provided by the manufacturer was used for data acquisition and analysis Study Population Laboratory ... (Becton Dickinson, Biosciences Pharmigen, San Diego, CA and USA) After Statistical analysis Analyses of the data were performed using Statistical Package for Social Sciences (SPSS) statistical...

Báo cáo khoa học: Characterization of the lipopolysaccharide and b-glucan of the ﬁsh pathogen Francisella victoria ppt

Danh mục: Báo cáo khoa học

... alanine, 3-aminobutyric acid (homoalanine or BABA), and a novel branched amino acid designated AA HMBC correlations allowed us to trace the BABA-acylated alanine, which was in turn linked to N-4 of terminal ... carbons, two of them protonated (59.4 and 66.5 p.p.m.) and one quaternary carbon at 79.0 p.p.m Proton signals at 4.23 and 4.73 p.p.m correlated with a quaternary carbon atom and carbonyl carbon ... membranes were then washed and further reacted with a : 4000 dilution of second antibody, goat antirabbit IgG conjugated to alkaline phosphatase (Caltag Laboratories, Burlingame, CA, USA) and developed...

báo cáo hóa học: " Comparison of the discriminative ability of a generic and a condition-specific OHRQoL measure in adolescents with and without normative need for orthodontic treatment" potx

Danh mục: Hóa học - Dầu khí

... defects of cleft lip and palate as well as any craniofacial anomaly, Class II and Class III buccal occlusions, and hypodontia Only the highest scoring trait is used to assess treatment need [29] Thereafter, ... Quality of Life Outcomes 2008, 6:64 ily related to the participant's oral impact In other words, occlusal traits that affect dental appearance and have an impact on participants' daily lives may ... revised the manuscript AS supervised the entire study and critically revised the manuscript All authors read and approved the final version of the manuscript Acknowledgements Eduardo Bernabé was supported...

báo cáo hóa học: " A randomised comparison of a four- and a five-point scale version of the Norwegian Function Assessment Scale" doc

Danh mục: Hóa học - Dầu khí

... FAD assisted statistical analysis and reviewed the manuscript BN participated in planning and designing the study, collected the data and participated in drafting the manuscript SB planned and ... Table 3: Mean item-total correlation and Cronbach's alpha for domain scores in the NFAS-4 and the NFAS-5 (N = 3325) Cronbach's alphaa NFAS-4 NFAS-5 Mean item-total correlation NFAS-4 NFAS-5 Walking/standing ... results and in drafting the manuscript AG helped in the interpretation of the results and participated in drafting the manuscript JSB performed most statistical analysis and reviewed the manuscript...

Báo cáo hóa học: " Closing two doors of viral entry: Intramolecular combination of a coreceptor- and fusion inhibitor of HIV-1" docx

Danh mục: Hóa học - Dầu khí

... Stuttgart, Germany) The integrity of the amino acid backbone of reduced mAb and mAb-FI light and heavy chains were verified by NanoElectrospray QTOF mass spectrometry after removal of N-glycans by ... describe the concept of an antiretroviral agent with dual mechanisms of action The bifunctional fusion inhibitor, BFFI, is an antibody-based entry inhibitor that combines the activity of an anti-CCR5 ... calculated on the basis of the amino acid sequence The purity and the proper tetramer formation of mAbs and mAb-FIs were analyzed by SDS-PAGE in the presence and absence of a reducing agent (5 mM...

Báo cáo hóa học: " On the maximum modulus of a polynomial and its polar derivative" potx

Danh mục: Hóa học - Dầu khí

... Inequalities and Applications 2011, 2011:111 http://www.journalofinequalitiesandapplications.com/content/2011/1/111 Page of The above lemma is due to Chan and Malik [11] Lemma 2.4 If p(z) is a polynomial ... refinement of a theorem of Paul Turan concerning polynomials Math Ineq Appl 1, 231–238 (1998) Jain, VK: Generalization of an inequality involving maximum moduli of a polynomial and its polar derivative ... is best possible and equality holds for p(z) = (z - k)n Aziz and Dawood [4] obtained the following refinement of the inequality (1.2) and proved that if p(z) has all zeros in |z| ≤ 1, then max...

Báo cáo hóa học: "Research Article Design of a Versatile and Low Cost μVolt Level A to D Conversion System for Use in Medical Instrumentation Applicatio" pdf

Danh mục: Hóa học - Dầu khí

... has been used to measure and proﬁle the beta radiation from an Sr-90 brachytherapy source and was found to be particularly easy to use and to provide stable and repeatable results [3] Due to the ... conventional sample and hold facility which, in the case of a hand-held instrument, allows for a “snapshot” of the data stream to be made manually at a time chosen by the operator Use of this additional ... connection to a PC or data logger where further analysis and storage of measurement data can occur The change in output frequency bears a linear relationship to the magnitude of the sensed phenomena, thus...

Step by Step Drawing of a Simple and Funny Cartoon Monkey ppt

Danh mục: Mỹ thuật

... proportionally longer than human arms I have exaggerated the arms a little bit as you can see The Legs & Tail Draw another two long rectangles to make the legs At the end of the legs draw two rectangles ... head to show the mouth area Add two little eyes above the oval Step - Body & Arms Draw two long skinny rectangles to form the arms At the eng of the arms draw an egg shape to make the form of the ... the hands When drawing a cartoon monkey keep the arms a little bit extra long If you have a chance to go to the zoo and look at the monkeys in there you can see that their arms are generally...

Báo cáo toán học: "Maximum Multiplicity of a Root of the Matching Polynomial of a Tree and Minimum Path Cover" pdf

Danh mục: Báo cáo khoa học

... 3.2]): Theorem 3.1 (Gallai-Edmonds Structure Theorem) Let G be any graph and let D0 (G), A0 (G) and C0 (G) be the 0-partition classes of G (i) (The Stability Lemma) Let u ∈ A0 (G) be a 0-special ... believe that diﬀerent proofs can be illuminating For the sake of completeness, we include the proof in the next section Theorem 3.3 (The Stability Lemma for Trees) Let T be a tree and let θ be ... known that the matching polynomial of a graph G is equal to the characteristic polynomial of G if and only if G is a forest To prove Theorem 3.3, the following characterization of θ-essential vertices...

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose

morphology change of an electrode consisting of sno2 nanoparticles a before and b after the 50 cycles 49