... conventional parameter apparatus such as temperature, pH and conductance etc., and water quality analysis apparatus such as NH4+-N, PO43—P and COD etc The instruments should be maintained regularly, ... Steps to establish amodeling WWTP Take Qinghe WWTP as an example a) Step Abstracting wastewater treatment process in the WWTP To establish amodeling WWTP, the first step is to carefully analyze ... WWTPs have their own data management systems, such as SCADA (Supervisor, Control and Data Acquisition) and control system with the function to pick up the analysis data and control the automatic...
... Yasuda, T., Sawazaki, K., Nadano, D., Takeshita, H., Nakanaga, M & Kishi, K (1993) Human seminal deoxyribonuclease I (DNase I): purification, enzymological and immunological characterization and ... analysis of the DNase I family The mammalian group formed a relatively tight cluster, while the snake (E quadrivirgata, E climacophora and A blomhoffii), amphibian (X laevis, Rana catesbeiana, ... obtained from the Japan Snake Institute, Gunma, Japan Phenyl Sepharose CL-4B, DEAE Sepharose CL-6B and Superdex 75 were purchased from Amersham Pharmacia Biotech; Concanavalin A (Con A) agarose...
... protein-1 APAF: apoptosis activating factor-1 Asp: aspartate ATP: adenosine triphosphate Bad: Bcl-2 antagonist of cell death Bak: Bcl-2 homologous antagonist killer Bax: Bcl-2-associated X protein ... polymerase (PARP) [36] or ICAD, the Inhibitor of caspase-activated DNAse PARP is a nuclear protein implicated in DNA repair and is one of the earliest proteins cleaved by caspases Cleavage of ICAD allows ... apoptosome Apoptosome formation then leads to the autocatalytic processing and activation of initiator caspase-9 [91-93] responsible for the activation of the executioner caspase cascade (incl caspase-3,...
... Corresponding histogram of the mitochondrial aggregation (B) n=2 90 LY30 and TRAIL treatment engages the mitochondrial apoptotic pathway The release of apoptogenic factors like cytochrome c or Smac/DIABLO ... 15B) In addition, an alternate analysis of the data for the 4h time point indicated that LY30+TRAIL treatment, and toa lesser extent LY30 alone, was inducing an early mitochondrial aggregation ... compared to untreated cells, with a peak of activity observed at 12h for all three caspases (Figure 1 8A, B and C) TRAIL treatment alone was unable to induce the activation of any of the caspases...
... mix CTAATACGACTCACTATAGGGCA AGCAGTGGTATCAACGCAGAGT Short primer: CTAATACGACTCACTATAGGGC CDS III primer ATTCTAGAGGCCGAGGCGGCCGA CATG-d(T)30VN SMART IIITM AAGCAGTGGTATCAACGCAGAGT Oligo GGCCATTATGGCCGGG ... GAATTCAACAAAGAGATAGAATT Forward primer for cloning SAM domain TGCAG into pGBKT7 SAM-R-Bam GGATCCTTATTTGTTGCAACTAAT Reverse primer for cloning SAM domain ATCAC into pGBKT7 SARM-F-Nde TACAGGACATATGGAAAATGGAT ... TACAGGACATATGGAAAATGGAT Forward primer for cloning CrSARMTCGCCC ORF into pGBKT7 SARM-R-Bam GGATCCTTAAAGTTCCACCGAAC Reverse primer for cloning CrSARMAAG ORF and CrSARM-AST into pGBKT7 TIR-F-Nde CAACAAACATATGACATTAGATG...
... related to each other and to mammalian a- crystallin Proc Natl Acad Sci USA 79, 2360–2364 12 Horwitz, J (1992) a- Crystallin can function as amolecular chaperone Proc Natl Acad Sci USA 89, 10449–10453 ... glyoxalase converts methylglyoxal to D-lactate [30] Abnormalities in Na/K-ATPase activity are thought to be involved in several pathologic states, in particular heart disease, hypertension and cataract ... cataract Altered Na+ and K+ concentrations are observed in many forms of human cataract and correlate with increasing lens colour and with cortical opacification [31] The change in monovalent cation...
... Poincare - Nancy J Robin 1994 Revision-based generation of Natural Language Summaries providing historical Background Ph.D thesis, Columbia University J Shaw 2002 Clause Aggregation: An approach to ... generation inspired by Tree Adjoining Grammar In A Abeille and O Rambow, editors, Tree Adjoining Grammars: Formalisms, linguistic analysis and processing, pages 343–370 CSLI, Stanford, CA C Gardent ... section was implemented in the GenI surface realizer (Kow, 2007), which uses a lexicalized feature-based Tree Adjoining Grammar to generate all possible paraphrases for a given flat semantic input...
... CD: Basic science and translational research in JAMA JAMA 2002, 287:1728 Marincola FM: Translational medicine: a two-way road J Transl Med 2003, 1:1 Zucker S, Cao J: Measurement of matrix metalloproteinases ... metalloproteinase-9 in human plasma Anal Biochem 2003, 322:283-286 Mannello F, Luchetti F, Canonico B, Papa S: Effect of anticoagulants and cell separation media as preanalytical determinants on zymographic ... zymographic analysis of plasma matrix metalloproteinases Clin Chem 2003, 49:1956-1957 Gerlach RF, Uzuelli JA, Souza-Tarla CD, Tanus-Santos JE: Effect of anticoagulants on the determination of plasma matrix...
... marshes, grasslands, and alluvial floodplains in its watershed The wetland area of Poyang Lake Basin has diverse flora and fauna and provides important habitats for many migratory birds As a wetland ... of acoustic signals as a means to measure and interpret ecological characteristics of a landscape—the soundscape Part V features innovative development and applications of wetland assessment and ... book emphasizes a watershed perspective in the modeling and assessment areas The term watershed means a geographic area where water drains into a body of water such as a river, lake, or wetland Other...
... 18 Wetland and Water Resource Modeling and Assessment Water Built-up Urban Welland Mud Beach Forest Grassland Bare Land Farmland Developing Urban Area (a) (b) FIGURE 2.4 The overall comparison ... bodies and built-up areas are close to roads and rails Thus, the spatial adjacency of these two objects to water bodies, the province-level roads, and railways were measured on the relevant thematic ... built-up area and muddy beach Figure 2.2 illustrates the special overlap between the built-up area and the muddy beach To improve the classification accuracy, the road data and DEM (the geographic...
... Spectroradiometer for Applications (AISA) AISA is a solid-state, push-broom instrument capable of collecting data within a spectral range of 430 to 900 nm in up to 286 spectral channels The sensor was ... the AISA image by field inspection Distichlis and Patens were combined into one category as high marsh, and low marsh was divided into Spartina pure, Spartina mixture, and Spartina stunted Marsh ... Troccoli, and L Capurro 2004 Coastal water quality assessment in the Yucatan Peninsula: Management implications Ocean & Coastal Management 47(11–12):625–639 Ko, J Y., and J D Day 2004 A review...
... landscape fragmentation index of Carex, ∑Ni stands for the total number of Carex landscape type polygons, and A is the total area of the Carex landscape The fragmentation index of the Carex landscape ... spectral angles among natural materials (lake water, reservoir water, land) spectra and the lake water endmembers, with the analysis results in Table 4.1 Traditionally, the spectral distance and ... The fact that the spectra of the same type are approximately linearly scaled versions of one another due to illumination and topographic variations is utilized to achieve accurate classification...
... populations around metropolitan areas will have a limited impact on interannual WASSI variability Even in heavily populated areas, residential and commercial water use represent small segments of total ... from these areas There are also several factors that control water demand In addition to residential water use, a great deal of water is also required by industry, irrigated farming, and the energy ... individual factors that influence regional water supply and demand across a range of environmental variability Some factors such as population are relatively stable from one year to the next,...
... is a meteorological observation station near the forest and grass catchments Daily precipitation and maximum and minimum air temperature observations from 2000 to 2001 are available, and they are ... months, water input is generally larger than water output The results indicate that annual change of soil water storage accounts for about 1.0% of rainfall From February to April, increasing rainfall ... rainfall and weak evaporation potential contribute to the increase in soil water storage, although a water deficit can exist From May to September, the soil water storage evinces a gradual decreasing...
... to have an appreciable reduction in streamflow after Eucalyptus grandis was planted over 97% of a native grassland watershed However, it took eight years to have a clear streamflow impact after ... Bai, S Chen, G Chu, and N Zhang 2004 Measured sap flow and estimated evapotranspiration of tropical Eucalyptus urophylla plantations in China Acta Botanica Sinica 46:202–210 Zhou, X, H Zhao, and ... the vegetated watersheds The average annual precipitation was about 400 mm Greater than 95% of precipitation evapotranspirated, and less than 5% precipitation became streamflow as infiltration-excess...
... unsaturated zone storage due to gravity drainage, and parameter td is a time constant Vertical drainage that depletes the water in the subsurface storm flow zone and replenishes the water stored ... Scale 94 Wetland and Water Resource Modeling and Assessment TABLE 8.1 Model parameters after calibration Parameter Description Value m SRMAX td Smaxsf Exponential storage parameter Root zone available ... MODEL CALIBRATION AND VALIDATION The observed daily precipitation, pan evaporation, and stream discharge from 1982 to 1985 are selected for model parameter calibration, and the daily data from...
... the surface storage, bsepS, and lateral flow toa downstream surface zone, asS, are linearly proportional to the surface zone moisture, S Additionally, evaporation and evapotranspiration are dependent ... since a basin is divided into lumped-parameter model applications to subbasins and land parcels to coarsely represent spatial variations of rainfall and land surface Moreover, neither SWAT nor ... the original lumped-parameter water balance model, we are able to easily represent the mass balance of both water and an arbitrary conservative pollutant spatially throughout all storage zones...
... snow pack and tanks; energy conservation applies to evapotranspiration The model allows surface and subsurface flows to interact both with each other and with adjacent-cell surface and subsurface ... the Cass River near Saginaw due to the flatness of the area The larger amount of sedimentation in the area is likely to have a negative impact on aquatic habitat It could also lead to elevated ... 10.2) and most of the area was in the agricultural land 10.4 ESTIMATING ANIMAL MANURE LOADING POTENTIAL Improper management of animal manure can result in eutrophication of surface water and nitrate...
... Department of Agriculture.6–8 Its GIS-based version (AVSWAT 2000) has strong functionality in spatial analysis and visualization The SWAT model can be used to evaluate the impact of land management ... natural topography, slope, and channel, (2) climatic and hydrological factors (temperature, solar radiation, precipitation, and runoff), and (3) biomass of natural vegetation Based on these boundary ... meteorological data over the last 200 years, statistical values (such as standard deviation, skew coefficient of the daily precipitation and temperature in a month, and the probability of a wet day after...
... spatial landscape analyses and serve as standards for comparison between landscapes in different parts of the world Linking water quality to landscape indices allows us to compare land and waterscapes ... desire to manage scale and data problems, such as the interaction among local and regional processes and the lack of adequate data for model calibration.9 Most other models simulate output based ... per class per year, (3) mean patch size per class per year, (4) patch size standard deviation per class per year, and (5) dominance All were calculated using the interactive data language (IDL)...