model calculated average a annual b march and c september nonstorm streamflow from subbasins of the assabet rive

Báo cáo y học: "Efficacy of a progressive walking program and glucosamine sulphate supplementation on osteoarthritic symptoms of the hip and knee: a feasibility trial" pot

Báo cáo y học: "Efficacy of a progressive walking program and glucosamine sulphate supplementation on osteoarthritic symptoms of the hip and knee: a feasibility trial" pot

Ngày tải lên : 12/08/2014, 11:23
... Economic Impact of Arthritis on Australia in 2007 Sydney: Arthritis Australia 2007 Access Economics: The Prevalence, Cost, and Burden of Disease of Arthritis in Australia Canberra, Australia: The Arthritis ... statistical analysis All authors participated in the interpretation of the data and the drafting of the manuscript, and all authors read and approved the final manuscript Competing interests All authors ... hip OA who have participated in aerobic exercise programs have experienced increases in aerobic capacity [11,12] and functional ability [13,14], and decreases in pain, fatigue, depression and anxiety...
  • 15
  • 260
  • 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Ngày tải lên : 07/03/2014, 05:20
... TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast strains used in this study Strain Genotype ... mutagenesis Primer Sequence (5¢- to 3¢) Vps4–DEL F Vps4–DEL R Vps4–TRP F Vps4–TRP R Vps4–RDF F Vps4–RDF R TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA ... Millipore (Bedford, MA, USA) Goat polyclonal anti-(yeast Vps4p) IgG was from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and rabbit polyclonal anti-(carboxypeptidase Y) and anti-calmodulin sera were...
  • 23
  • 490
  • 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx

Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx

Ngày tải lên : 17/03/2014, 03:20
... CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA ... AtxBFb (F) AtxBrcb (R) AtxACFc (F) AtxACrcc (R) AmlFd (F) Amlrcd (R) CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC ... CTGTGgtgag/tgcagGAGGC (110) GACCGgtaag/tccagCTGCT CTGTGgtgag/tgcagGAGGC (110) AGGCGgtgag/tccagTTGAA GACCGgtaag/tccagCTGCT GTGCGgtgag/tgtagGAGAC (110) AGGCGgtgag/tttagTTGAG GACCGgtaag/tccagCTGCT CTGCGgtgag/tgcagGAAAA...
  • 10
  • 451
  • 0
Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx

Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx

Ngày tải lên : 24/03/2014, 04:21
... 50 -CTCAGAAGCCTGATGTCTA-30 30 -GAGAAGTGGGAGGTCGTT-50 166 S2 1458–1476 1676–1695 50 2CTGCTGGGCCCCTCCTGC-30 30 -GACGTTCCAGGCCTCACAG-50 237 q FEBS 2001 followed by 72 8C for 10 The primer sequences ... PCR were: TMD (1720–1738), 50 -tgcagctgccagataaga-30 and (2065–2083) 30 -GGCTTGAGTGGATGATTT-50 ; the product generated was 363 bp Blood collection and processing Blood was collected from each ... Varkin, A.< /b> J (1994) The oligosaccharide binding specificities of CD22 beta, a < /b> sialic acid-speci c lectin of B cells J Biol Chem 269, 10628–10636 32 Collins, B. E., Kiso, M., Haseqawa, A.< /b> , Hasegawa,...
  • 14
  • 540
  • 0
Báo cáo khoa hoc:" Vitamin D and oestrogen receptor polymorphisms in developmental dysplasia of the hip and primary protrusio acetabuli – A preliminary study" ppt

Báo cáo khoa hoc:" Vitamin D and oestrogen receptor polymorphisms in developmental dysplasia of the hip and primary protrusio acetabuli – A preliminary study" ppt

Ngày tải lên : 11/08/2014, 08:21
... diagnosis of DDH or PPA was made on the basis of clinical and radiographic examination A < /b> control group of 101 subjects (age 18–60) was recruited from the same geographical region and the same ethnic ... femoral head to a < /b> line drawn from the centre of the head to the lateral edge of the acetabulum on antero-posterior radiographs of the pelvis [25] The acetabular index was measured as described by ... special reference to the complication of osteoarthritis Acta Chir Scand Suppl 1939, 83:1-130 Sharp IK: Acetabular dysplasia: the acetabular angle J Bone Joint Surg 1961, 43 -B: 268-72 Iwase T, Hasegawa...
  • 5
  • 519
  • 0
báo cáo khoa học: " Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits" pps

báo cáo khoa học: " Construction of a potato consensus map and QTL meta-analysis offer new insights into the genetic architecture of late blight resistance and plant maturity traits" pps

Ngày tải lên : 11/08/2014, 11:21
... Solanaceae genera (potato, tomato, pepper, petunia, tobacco and Nicotiana benthamiana) [50] Because the number of sequence matches among different Solanaceae EST libraries was inversely correlated ... file and on the SGN database [37] QTL dataset for meta-analysis Table Number of publications, maps and QTLs collected to perform meta-analysis No of publications No of maps No of QTLs Available ... described in the original publication when available (interval length of a < /b> certain LOD decrease) Otherwise, the confidence interval estimate was calculated < /b> with the empirical formula of Darvasi and Soller...
  • 17
  • 593
  • 0
Reservoir delineation and cumulative impacts assessment in large river basins a case study of the yangtze river basin

Reservoir delineation and cumulative impacts assessment in large river basins a case study of the yangtze river basin

Ngày tải lên : 09/09/2015, 08:12
... capacity-area and capacity-runoff ratios for some large world rivers 100  Table 4.5 Sub-basins, their general characteristics, reservoir capacity data and information on capacity-area ... 138  Table 6.1 Tributaries, their general characteristics, reservoir capacity data and X information on capacity-area and capacity-runoff ratios 158  Table 6.2 Summary of model < /b> parameterization ... coordinates (latitude and longitude), catchment area, mean monthly and annual < /b> water discharge, and the magnitude and date of occurrence of the maximum and minimum daily discharges (Yan et al.,...
  • 330
  • 609
  • 0
The herpetofauna of the peruvian dry forest along the andean valley of the marañón river and its tributaries, with a focus on endemic iguanians, geckos and tegus

The herpetofauna of the peruvian dry forest along the andean valley of the marañón river and its tributaries, with a focus on endemic iguanians, geckos and tegus

Ngày tải lên : 19/11/2015, 15:51
... sechurae), the puma (Puma concolor), the jaguar (Panthera onca), the ocelot (Leopardus pardalis) the tayra (Eira barbara), the collared peccary (Pecari tajacu), and the northern viscacha (Lagidium ... Huancabamba and Utcubamba rivers and tributaries (Regions Piura, Cajamarca, Amazonas) southwards along the deep and narrow valleys of the Marañón River and its tributaries to the Region La Libertad ... 1999, Brack 2004) The Huancabamba Depression in the Piura, Cajamarca, Amazonas and San Martin Regions is the major structural and physiographic break of the Andes consisting of a < /b> complex system of...
  • 264
  • 492
  • 0
Tiểu luận xử lý vi phạm về vệ sinh môi trường tại chợ a – huyện b, thành phố c

Tiểu luận xử lý vi phạm về vệ sinh môi trường tại chợ a – huyện b, thành phố c

Ngày tải lên : 30/01/2016, 12:53
... luật c ng t c quản lý kinh doanh khai th c chợ Kế hoạch tổ ch c th c 5.1 Xây dựng kế hoạch TT Nội dung Thời gian Đ a < /b> C c tổ ch c cá Ghi điểm nhân tham gia Kiểm tra vi phạm Ngày Tại chợ C n phụ ... tế với ch c tham mưu UBND huyện B lĩnh v c thương mại triển khai b c xử lý c ng vi c cụ thể với tinh thần trách nhiệm cao Để đến định cuối kiện toàn l c Hợp t cB triển khai nhiều b c từ kiểm ... phải tham mưu cho UBND huyện X c ng t c quản lý chợ Hợp t cB Tồn hay không tồn “Chuyển đổi mô hình quản lý kinh doanh khai th c chợ từ bao c p sang mô hình doanh nghiệp, Hợp t c xã chủ trương...
  • 23
  • 5.4K
  • 67
Tài liệu Investigation of Organic Chemicals Potentially Responsible for Mortality and Intersex in Fish of the North Fork of the Shenandoah River, Virginia, during Spring of 2007 ppt

Tài liệu Investigation of Organic Chemicals Potentially Responsible for Mortality and Intersex in Fish of the North Fork of the Shenandoah River, Virginia, during Spring of 2007 ppt

Ngày tải lên : 14/02/2014, 08:20
... surface area of 41 square centimeters (cm2) and a < /b> membrane surface area to sorbent mass ratio of 180 square centimeters per gram (cm2/g) conforming to the specification of a < /b> standard POCIS (Alvarez ... (when available), the bioavailable concentrations of analytes in POCIS and SPMDs can be estimated The effects of exposure conditions on the chemical uptake and dissipation rates into passive samplers ... the reliability of the data obtained The QC samples for the SPMDs and POCIS consisted of fabrication and field blanks intended to determine the presence of any contamination of the sampler matrix...
  • 24
  • 865
  • 0
Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx

Ngày tải lên : 19/02/2014, 00:20
... with the following primers: QsCgClp1 (5¢-CTTCCTCCGCTTCCATGA-3¢) and QaCgClp1 (5¢-CCATGAAGTCCGCGAATC-3¢); and QsCgClp2 (5¢-GCATAGCGATGTGGACGA-3¢) and QaCgClp2 (5¢-GAGGACCGAGACCGTGAA-3¢) The abbreviations ... other hand, both LPS and peptidoglycan harbour GlcNAc, the constituent of chitin, in their molecular structure A < /b> possibility is that Cg-Clp1 and Cg-Clp2 bind to bacteria via these cell wall components; ... 2B) Transcripts were detected in both epithelial and conjunctive cells of the mantle Cg-Clp1 and Cg-Clp2 mRNA levels are increased in haemocytes after bacterial LPS challenges As the two mammalian...
  • 9
  • 584
  • 0
Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

Ngày tải lên : 19/02/2014, 17:20
... catcgttgtactgcttgctggcaccaaaaagctc gttgtactgctttttgccaccaaaaagctcgg gctttttggcaccaaagccctcggctccatcgg gctttttggcaccaaaaaggccggctccatcg ggttccgatcttgctgcgtcgatcaaagg gcgtcgatcaaaggcgctaaaaaagcaatgagcg ... cggttttagcgaactgctaggggggggcatcatcggc gcgaactgctattgcccttcatcatcggcctcg ctcgtcgttctggcaccgcaacgactgcc ctcgtcgttctggggggacaacgactgcc gtcgttctggggctacaacgactgcctgtg ggggccgcaacgagcgcctgtggcgg cgcaacgactggctgtggcggtaaaaac ... caggtgtgggcagctatcgccccagcgc ggcatttatcgccgctgcgctgtataagcatg cgccccagcggcgtataagcatgaacgtcg gctgtataagcatcagcgtcgcctggtggtg gctgtataagcatgcacgtcgcctggtg ctgtataagcatgaagctcgcctggtggtgcc gtataagcatgaacgtgccctggtggtgccg...
  • 15
  • 532
  • 0
Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt

Báo cáo khoa học: A steady-state modeling approach to validate an in vivo mechanism of the GAL regulatory network in Saccharomyces cerevisiae ppt

Ngày tải lên : 07/03/2014, 16:20
... consider four candidate models, Models I–IV, shown in Figs 1–3, to validate the mechanism of induction of GAL genes by galactose In each of the models, cytoplasmic Gal3p is activated by galactose ... Fig Schematic representation of candidate models, Model < /b> II and Model < /b> III, for the GAL genetic switch in the presence of galactose Model < /b> II assumes that activated Gal3p enters the nucleus and binds ... cell by eliminating infeasible mechanisms The response curve can be quantified by a < /b> Hill equation and is characterized by two parameters, namely, the Hill coefficient and the half saturation constant...
  • 11
  • 490
  • 0
Water-Quality Data from Semipermeable-Membrane Devices and Polar Organic Chemical Integrative Samplers Deployed in the McKenzie River Basin, Oregon pptx

Water-Quality Data from Semipermeable-Membrane Devices and Polar Organic Chemical Integrative Samplers Deployed in the McKenzie River Basin, Oregon pptx

Ngày tải lên : 14/03/2014, 20:20
... River Basin, Oregon By Kathleen A < /b> McCarthy and David A < /b> Alvarez Abstract Two types of passive samplers the semipermeable membrane device (SPMD) and the polar organic chemical integrative sampler ... Water-Quality Data from Semipermeable-Membrane Devices and Polar Organic Chemical Integrative Samplers Deployed in the McKenzie River Basin, Oregon By Kathleen A < /b> McCarthy and David A < /b> Alvarez ... Suggested citation: McCarthy, K .A.< /b> , and Alvarez, D .A.< /b> , 2012, Water-quality data from semipermeable-membrane devices and polar organic chemical integrative samplers deployed in the McKenzie River basin,...
  • 14
  • 477
  • 0
Simulation of Ground-Water Flow and Evaluation of Water-Management Alternatives in the Assabet River Basin, Eastern Massachusetts pptx

Simulation of Ground-Water Flow and Evaluation of Water-Management Alternatives in the Assabet River Basin, Eastern Massachusetts pptx

Ngày tải lên : 17/03/2014, 15:20
... Model-< /b> calculated < /b> components of average < /b> A,< /b> March; and B, September nonstorm streamflow in subbasins of the Assabet River Main Stem, in a < /b> hypothetical scenario of increased withdrawals and discharges ... components of average < /b> A,< /b> March; and B, September nonstorm streamflow in subbasins of the Assabet River Main Stem 32 Model-< /b> calculated < /b> average < /b> A,< /b> March and B, September total ... ground-water-flow system in subbasins of the A,< /b> Assabet River Main Stem; and B, tributary subbasins, in a < /b> hypothetical scenario of increased withdrawals and discharges in the Assabet River Basin ...
  • 142
  • 1.4K
  • 0
Cancer incidence, mortality and survival by site for 14 regions of the world. pdf

Cancer incidence, mortality and survival by site for 14 regions of the world. pdf

Ngày tải lên : 22/03/2014, 16:21
... Excluded Mouth and oropharynx cancers Oesophagus cancer Stomach cancer Colon and rectum cancers Melanoma and other skin cancers Breast cancer Cervix uteri cancer Corpus uteri cancer Ovary cancer ... rectum cancers Liver cancer Pancreas cancer Trachea, bronchus and lung cancers Melanoma* Breast cancer Cervix uteri cancer Corpus uteri cancer** Ovary cancer GLOBOCAN 2000 GBD 2000 Version Prostate ... Prostate cancer Bladder cancer Lymphomas and multiple myeloma Leukaemia Other malignant neoplasms (excluding garbage codes)* Liver cancer Pancreas cancer Trachea, bronchus and lung cancers Ovary cancer...
  • 47
  • 288
  • 0
THE VALLEY OF SILENT MEN A STORY OF THE THREE RIVER COUNTRY pdf

THE VALLEY OF SILENT MEN A STORY OF THE THREE RIVER COUNTRY pdf

Ngày tải lên : 22/03/2014, 18:20
... was bringing him in to be hanged And there were McTab, and le B te Noir the Black Beast a < /b> lovable vagabond in spite of his record, and Le Beau, the gentlemanly robber of the wilderness mail, and ... the rocks and rapids of the Grand Cascade, the whirlpools of the Devil's Mouth, the thundering roar and boiling dragon teeth of the Black Run—on to the end of the Athabasca, to the Slave, and into ... Ocean, and the smaller craft, with their still wilder crews, had come up the river toward civilization The River, as the Landing speaks of it, is the Athabasca, with its headwaters away off in the...
  • 185
  • 392
  • 0
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot

Ngày tải lên : 23/03/2014, 04:21
... plasmid The gene was amplified from this plasmid by PCR using forward primer 5¢-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACTTATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3¢ ... features of bB2 crystallin Gambeta’s structural ⁄ biochemical characteristics are derived partly from bB2 and partly from cB Figure 2B shows that the CD spectrum of Gambeta has a < /b> typical negative band ... and E deriving from the XhoI restriction site Likewise, we also amplified the cDNA for bB2 using forward primer 5¢-ACTTATACTACTCATATGCTCAACCC CAAGATCATC-3¢ and reverse primer 5¢-ACTTATAC TATCCTCGAGCCACTGCATGTCCCGG-3¢,...
  • 13
  • 430
  • 0