modality 2 nuclear ventilation perfusion imaging
Tài liệu Triển khai Vista – Phần 2: Tìm hiểu về Windows Setup và Windows Imaging File Format ppt
... trình cài đặt Windows Install image image đựợc capture hệ điều hành Windows Vista Windows Server 20 08 cài đặt để áp dụng vào hệ thống Chúng ta làm sáng tỏ vấn đề này: bạn sử dụng boot image để ... thích cách cấu hình phần Dù sao, tất thực giai đoạn Windows PE kết thúc giai đoạn bắt đầu Giai đoạn 2: Online Configuration Trong suốt giai đoạn Setup thực hành động cấu hình để làm cho cài đặt Windows...
- 4
- 538
- 1
Tài liệu Photoshop - Một vài điều cần biết về Kỹ Thuật Digital Imaging! (Phần 2) pdf
... Resolution 26 7 PPI, Hình in size 12inx8in Ở điều kiện thường tình, ta chọn PPI từ 22 0 , trở lên 26 7, 300, hay 360 ta yên tâm có hình in tốt! – Bây ta lấy thông số Image Screen Resolution 26 7 chia ... view hình screen (RGB) với độ trung thực mà không bị méo mó (distort) nên chọn levels sau 25 %, 50%, 100%, 20 0%, 300%, 400% – Don’t trust me, Hãy tin vào mắt bạn Photoshop! Cho tới Photoshop tìm ... Nhiều lần nhiều nơi, thường gặp hàng chữ Screen resolution= 72 PPI Vậy mang ý nghĩa gì? – PPI chữ tắt Pixcel per inch Thưa bạn, thời hình 72 PPI xưa rồi, thực vào dĩ vãng Đó thời kỳ hình năm 1983,...
- 12
- 506
- 3
Nuclear Power Control, Reliability and Human Factors Part 2 pot
... language and HDL 2. 2 .2 Different CASE2.3 .2 Different HDLs tools kinds 2. 3.3 -2. 3.8 Combi2 .2. 3 Different CASEnation of diverse tools configurations CASE-tools and HDLs 3.3.1 Joint use of 3 .2. 1 Different ... 0543-19 72, ISSN 1573-8906 Feng, Z.; Wang, Q & Shida, K (20 07) A Review of Self-validating Sensor Technology, Sensor Review, Vol 27 , No.1, pp 48-56, ISSN 026 0 -22 88 Feng, Z.; Wang, Q & Shida, K (20 09) ... on Instrumentation and Control in Nuclear Power Plants” ( 621 - 12- TM -26 9 32) 13-16 Sept 20 05, Chatou, France (CD-ROM) Stroble, J.K.; Stone, R.B & Watkins, S.E (20 09) An Overview of Biomimetic Sensor...
- 30
- 371
- 0
Nuclear Power System Simulations and Operation Part 2 potx
... simulators in the nuclear power generating industries 3 .2 Simulation in design and authorization Nowadays it is more difficult to get the approval of the authorities for constructing a new nuclear power ... problems of the simultaneous numerical solution (Hazi, Kereszturi et al., 20 02) The crucial point is: how to nodalise the nuclear reactor and the primary circuit in order to achieve high fidelity ... Simulators for Nuclear Power Generation worse It is impossible to set a valve or control rod to an exact position if the time resolution of these inputs is only one second or even 0 .2 second It...
- 15
- 356
- 0
Nuclear Power Deployment Operation and Sustainability Part 2 pot
... and Decay Chain Fission Products He4 Pb206 Pb207 Pb208 Pb210 Bi209 Ra 226 Ra 228 Ac 227 Th 228 Th 229 Th230 Th2 32 Pa231 U2 32 U233 U234 U235 U236 U238 Np237 Pu238 H3 Transition Metals C14 C-other Kr81 ... One S6W nuclear reactor, one shaft SSN 21 and SSN 22 : 353 feet (107.6 meters) SSN 23 : 453 feet (138 meters) 40 feet ( 12. 2 meters) SSN 21 and SSN 22 : 9,138 tons (9 ,28 4 metric tons) SSN 23 12, 158 ... Am243 Ce144 w/Pr144m/Pr144 decay Cm2 42 Curium Pm147 Cm243 Sm146 Cm244 Sm147 Cm245 Sm151 Cm246 Eu154 Cm247 Eu155 Cm248 Ho166m Cm250 LA-other plus Yttrium Bk249 Berkelium Cf249 Californium Cf250...
- 35
- 367
- 0
Nuclear Power Operation Safety and Environment Part 2 potx
... Energy Agency (20 02) Accident Analysis for Nuclear Power Plants, Safety Reports Series No 23 , IAEA ISBN 92 0–1156 02 2, Vienna NIKIET 19 92 Accident Analysis of rupture of fuel channel 52- 16 at Leningrad ... – 100–300 5–15 / 5–15 – 25 25 –/– – 20 –60 30–60 20 –30 / 20 –30 – 7–30 0.4 / – 0.8 – 10–5 – / 10–7 – 30 30 (5–6)·103 / (5–6)·103 40–50 0.6–1.4 0.6–1.4 0.8 2 / 0.8 2 1 2 8–9 9–9.5 9–9.5 / 9–9.5 ... 19 – mixer; 20 – start-up separator; 21 – intermediate steam reheater; 22 – low-pressure regenerative preheater; 23 – high-pressure regenerative preheater; 24 – feed turbo-pump; and 25 – booster...
- 30
- 396
- 0
Nuclear Power Part 2 potx
... Isotope 23 2U Half-Life, T1 /2 [yr] 68.9 704 x 106 23 8Pu 87.7 23 9Pu 24 x 103 24 1Pu 14.35 24 1Am 4 32. 2 24 2mAm 141 24 3Cm 29 .1 24 4Cm 18.1 24 9Cf 351 25 1Cf 900 Table Properties of relevant actinides 23 5U ... Baseline Actinides: Isotopes Uranium 23 5U Plutonium 23 8Pu, 23 9Pu, 24 1Pu Selected Actinides: Uranium 23 2U Americium 24 1Am, 24 2mAm Curium 24 3Cm, 24 4Cm Californium 24 9Cf, 25 1Cf Table Baseline and selected ... 0.01006 9.8 x 10-10 0.00790 2. 8 x 10-05 0.04830 0.00160 0.00491 0. 023 81 0.03 829 0.00197 0.00077 22 2. 2 x 10-6 17 6.3 x 10 -2 100 3.5 9.8 52 82 4.1 1.6 Analysis of the nuclear data for actinides...
- 30
- 195
- 0
báo cáo hóa học: " In vitro and in vivo pre-clinical analysis of a F(ab’)2 fragment of panitumumab for molecular imaging and therapy of HER1-positive cancers" pot
... F(ab’ )2 in athymic Time points (h) Tissue 24 48 72 96 168 Blood 6.84 ± 2. 30 2. 28 ± 0.53 1. 12 ± 0 .27 0. 32 ± 0. 12 0.08 ± 0. 02 Tumor Liver 21 . 42 ± 7.67 8.01 ± 1.63 21 . 12 ± 2. 85 4.98 ± 0.98 21 .55 ± 6 .2 ... ± 1.14 2. 23 ± 0.39 1.79 ± 0.31 1.06 ± 0 .21 0.8 ± 0 .26 Heart 3.57 ± 1.11 2. 06 ± 0 .23 1.86 ± 0.30 1 .20 ± 0 .21 0.78 ± 0. 12 Femur 2. 41 ± 0.48 1.78 ± 0.41 1.67 ± 0 .24 1.01 ± 0 .24 0.75 ± 0 .22 Athymic ... 4.66 ± 0. 62 16.55 ± 2. 35 3.55 ± 0. 62 8.01 ± 3.65 3.38 ± 0.67 Spleen 5.43 ± 1.64 3.61 ± 0.87 3.96 ± 1.19 2. 63 ± 1. 12 2.09 ± 0.80 Kidneys 13.13 ± 2. 34 8 .27 ± 0.84 6.00 ± 1.57 5 .22 ± 0.94 2. 66 ± 0.46...
- 15
- 452
- 0
Nuclear Magnetic Resonance 2 doc
... CP-TOSS spectra of the polymorphs of SKF105517 free base O O H 3C 10 NH 11 12 OH 15 13 O 16 14 17 19 18 20 NH 21 22 26 23 25 24 Amorphous forms generally give broadened spectra 11 An Example: Polymorphism ... 15N SSNMR spectroscopy also shows similar effects O O H 3C 10 NH 11 12 OH 15 13 O 16 14 17 19 18 20 NH 21 22 26 23 25 24 Advantages: simple and easy-to-interpret spectra, valuable information ... 5-nitro -2- pentanol NO2 3.51q 7.4-7.5m H 3CO NO 4.45t 3.55q H3CO 2. 02m Ph F3C 1.69m O O (S)-MPTA-Cl => (R)-MPTA ester Ph 1 .26 d CH3 10 F 3C 11 H 5.15m (R)-alcohol |5J H9,F10| = 1 .2 Hz | J H11,H5| = 6.2...
- 14
- 291
- 0
Pocket Atlas of Sectional Anatomy Computed Tomography and Magnetic Resonance Imaging - Volume II Thorax, Heart, Abdomen, and Pelvis (Part 2 ) doc
... 10 11 12 13 14 15 159 20 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 21 45 22 46 16 17 18 19 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 Lumbar vertebra ... terms and conditions of license Coronal 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 Duodenum Inferior vena cava Ascending ... © 20 07 Thieme All rights reserved Usage subject to terms and conditions of license Coronal 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 ...
- 116
- 362
- 0
XỬ TRÍ ĐƯỜNG KHÍ VÀ SỰ THÔNG KHÍ PHỔI (GESTION DE L’AIRWAY ET DE LA VENTILATION) - PHẦN 2 ppsx
... tự nhiên (ventilation spontanée) không thích đáng hay vắng mặt, phải bắt đầu thông khí nhân tạo (ventilation artificielle) nhanh tốt Sự thông khí khí thở (thông khí “cứu miệng-miệng”, ventilation ... nồng độ oxy thở vào 85% lưu lượng 10-15 L/ phút Phải theo dõi độ bảo hòa oxy pulseoxymètre (Sp 02) hay khí máu động mạch để sau định chuẩn nồng độ oxy thở vào VII/ HÚT Các máy hút, với ống hút ... bất động đầu cổ VI/ OXYGENE Phải luôn cho oxy có sẵn Một mặt nạ loại Venturi cấp nồng độ oxy từ 24 đến 60% tùy theo mặt nạ lựa chọn Một mặt nạ oxy chuẩn mang lại đến 50% oxy, miễn lưu lượng oxy...
- 9
- 309
- 0
OPTICAL IMAGING AND SPECTROSCOPY Phần 2 ppt
... (3 :20 ) À1 Localization Defining mf ¼ s2 f ¼ ð jj f jj xj f (x)j2 dx (3 :21 ) (x À mf )2 j f (x)j2 dx (3 :22 ) ^ uj f (u)j2 du (3 :23 ) ^ (u À m f^ )2 j f (u)j2 du (3 :24 ) À1 ð jj f jj2 À1 ð mf^ ¼ ^jj2 ... region 2? 2. 2 Materials Dispersion The dispersive properties of a refractive medium are often modeled using the Sellmeier equation n2 (l) ¼ þ B1 l2 B2 l2 B3 l2 þ þ l2 À C1 l À C2 l À C3 (2: 66) ... TABLE 2. 1 Dispersion Coefficients of SF14 Glass B1 B2 B3 C1 C2 C3 1.691 825 38 0 .28 5919934 1. 125 95145 0.01331515 42 0.06 126 47445 118.40 524 2 PROBLEMS 51 2. 3 Microscopy A modern microscope using an infinity-corrected...
- 52
- 323
- 0
Pediatric PET Imaging - part 2 ppsx
... 2. 7E - 02 2.7E - 02 2.5E - 02 2.9E - 02 1.2E - 01 3.6E - 02 2.2E - 02 2.1E - 02 2.1E - 02 2.2E - 02 3.0E - 02 2.5E - 02 2.2E - 02 1.6E - 02 2.2E - 02 2.6E - 02 2.2E - 02 2.1E - 02 3.9E - 02 2.2E ... 02 1.9E - 02 8.1E - 02 2.5E - 02 1.4E - 02 1.4E - 02 1.4E - 02 1.5E - 02 2.0E - 02 1.6E - 02 1.4E - 02 1.0E - 02 1.4E - 02 1.6E - 02 1.5E - 02 1.3E - 02 2.6E - 02 1.4E - 02 2.5E - 02 2.2E - 02 ... 1.2E - 02 1.6E - 01 1.1E - 02 2.8E - 02 8.6E - 03 1.2E - 02 15 years 1.5E - 02 2.1E - 01 1.4E - 02 2.8E - 02 1.1E - 02 1.5E - 02 10 years 2. 4E - 02 2.8E - 01 2. 2E - 02 3.0E - 02 1.8E - 02 2.3E...
- 59
- 515
- 1
Báo cáo y học: "Cerebral misery perfusion diagnosed using hypercapnic blood-oxygenation-level-dependent contrast functional magnetic resonance imaging: a case report" potx
... 1996, 37(3) :22 4 -22 9 Silverman IE, Restrepo L, Matthews GC: Poststroke Seizures.” Arch Neurol 20 02, 59 (2) :195 -20 1 Derdeyn CP, Cross DT, Moran CJ, Dacey RGJ: Reversal of focal misery perfusion after ... Interdisciplinary Approach 20 05, 15(3) :21 5 -22 7 Mori E: Extracranial-intracranial arterial bypass surgery revisited International Journal of Stroke 20 08, 3(s1) :2- 474 doi:10.1186/17 52- 1947-4-54 Cite this ... Zaharchuk G, Caillé J, Dousset V, Yonas H: Comparative overview of brain perfusion imaging techniques Stroke 20 05, 36 :20 32- 2033 Han SW, Kim SH, Kim JK, Park CH, Yun MJ, Heo JH: Hemodynamic changes...
- 5
- 236
- 0
Genitourinary tract imaging - part 2 doc
... 25 RADIOLOGIC CLINICS OF NORTH AMERICA Radiol Clin N Am 46 (20 08) 25 –43 Nuclear Imaging in the Genitourinary Tract: Recent Advances and ... been important components of nuclear medicine practice [1–3] With the introduction of new imaging agents and procedures, these techniques can provide valuable data on perfusion and function of individual ... radionuclide imaging of the genitourinary tract - - - - Other imaging modalities Future prospects Clinical applications Indications Pitfalls and limitations Future prospects Other imaging modalities...
- 2
- 104
- 0
báo cáo khoa học: " The redox-sensitive transcription factor Rap2.4a controls nuclear expression of 2-Cys peroxiredoxin A and other chloroplast antioxidant enzymes" pps
... Csd2: At2g28190; Lhca2.1: At3g61470; Lhca5: At1g45474; Lhcb2 .2: At2g05070; PetC: At4g0 328 0; PetE: At1g76100; Rap2.4a: At1g36060; Rap2.4b: At1g78080; Rap2.4c: At2g 222 0; Rap2.4d: At1f 221 90; Rap2.4e: ... F1 DNA Protein + F2 + + + F3 + + + F4 + + + F5 + + + free RAP2.4a + + Rap2.4a Rap2.6 Rap2 .2 ERF4/Rap2.5 Rap2.3 Apetala2 Rap2.7 Rap2.8 Rap2.1 Rap2.10 CBF1 DREB2A C RAP2.4a E RAP2.6 F4 CE3: CTCCGGTCACGCGATTCAAC ... 130 n.d ZAT10 Rap2.4a 145 85 2CPA 61 Apx2 126 Csd2 PetE 83 sAPx 103 PetC 94 chlGR 82 50 Lhcb2 .2 tAPx 81 37 Rap2.4d ApL3 90 44 Lhca2.1 123 76 Lhcb4.1 83 Rap2.4e Rap2.4b 98 Lhca5 Rap2.4c Figure (A)...
- 14
- 247
- 0
Báo cáo y học: " Presence of a functional but dispensable Nuclear Export Signal in the HTLV-2 Tax protein" pdf
... Chem 20 04, 27 9(41):43307-43 320 Meertens L, Pise-Masison C, Quere N, Brady J, Gessain A, Mahieux R: Utilization of the CBP but not the p300 co-activator by 18 19 20 21 22 23 24 25 26 27 28 29 30 ... Wigdahl B: Characterization of a nuclear export signal within the human T cell leukemia virus type I transactivator protein Tax J Biol Chem 20 03, 27 8 (24 ) :21 814 -21 822 Felber BK, Paskalis H, Kleinman-Ewing ... Science 1985, 22 7(4691): 122 7- 122 8 Kiyokawa T, Kawaguchi T, Seiki M, Yoshida M: Association of the pX gene product of human T-cell leukemia virus type-I with nucleus Virology 1985, 147 (2) :4 62- 465 Slamon...
- 11
- 242
- 0
Cardiovascular Imaging A handbook for clinical practice - Part 2 pps
... Eur J Echocardiogr 20 04;5 :21 2 22 Kuhl HP, Schreckenberg M, Rulands D, et al High-resolution transthoracic real-time three-dimensional echocardiography J Am Coll Cardiol 20 04;43 :20 83–90 Hundley WG, ... epidemic JAMA 20 03 ;28 9:194 20 2 Fedak PW, Verma S, David TE, Leask RL, Weisel RD, Butany J Clinical and pathophysiological implications of a bicuspid aortic valve Circulation 20 02; 106:900–4 Rosenhek ... Atlas der Transösophagealen Echokardiographie Stuttgart: Thieme, 20 00.) RA LV BCI2 6/17/05 24 10:04 PM Page 24 Chapter Role of imaging in management decisions in mitral regurgitation The decision...
- 31
- 373
- 0
Báo cáo y học: " Administration of hydrogen sulfide via extracorporeal membrane lung ventilation in sheep with partial cardiopulmonary bypass perfusion: a proof of concept study on metabolic and vasomotor effects" ppt
... 2. 0 5.1 ± 1.5 5 .2 ± 1.7 5.8 ± 2. 3 5.5 ± 1 .2 CVP, mmHg 9 2 ± 1.0 10 ± 11 ± 11 ± 11 ± PCWP, mmHg 7 2 7 2 7±8 8 2 9 2 10 ± SVR, dyn·s/cm5 PVR, dyn·s/cm5 1,843 ± 435 145 ± 32 1,948 ± 525 191 ± 52b ... competing interests Received: 22 September 20 10 Revised: 15 December 20 10 Accepted: February 20 11 Published: February 20 11 Page of 10 15 16 17 18 19 20 21 22 23 24 References Arrich J, Holzer ... ppm 20 0 ppm ppm 300 ppm HR, beats/min 139 ± 24 MAP, mmHg 110 ± 13 148 ± 29 154 ± 1 72 ± 28 165 ± 28 150 ± 31 117 ± 14 115 ± 11 128 ± 16 121 ± 15 66 ± 11b MPAP, mmHg 15 ± 19 ± 3* 19 ± 22 ± 20 ±...
- 10
- 390
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25