methods that test a model using external data
Báo cáo " Calibration and verification of a hydrological model using event data " ppt
... measurable quantities of basin characteristics [6] and hence model calibration is needed Using the observed rainfall and evaporation data of each storm event as inputs, model will automatically ... introduced above, Gia Vong – a river basin in Quang Tri was taken as a case study (Figure 3.1) The basin has an area of about 275 km2, a perimeter of 111.9 km and an average rainfall of 2500 mm/year ... The rainfall data were collected at Gia Vong station The temporal resolution for rainfall is hours It seems relatively large for a small basin like Gia Vong MIKE-NAM requires evaporation data as...
- 11
- 440
- 0
Báo cáo nghiên cứu khoa học " Calibration and verification of a hydrological model using event data " pot
... measurable quantities of basin characteristics [6] and hence model calibration is needed Using the observed rainfall and evaporation data of each storm event as inputs, model will automatically ... rainfall is hours It seems relatively large for a small basin like Gia Vong MIKE-NAM requires evaporation data as input for the model The daily evaporation data at Khe Sanh station were used as ... rivers, namely Ben Hai, Thach Han and O Lau Gia Vong is located at Ben Hai river Figure 3.2 Average monthly rainfall at Gia Vong station over the period 1977-2009 Data available: For this study, rainfall...
- 11
- 330
- 0
AN1210 using external data memory with PIC24F24HdsPIC33F devices
... Viejo, CA Tel: 949-462-9523 Fax: 949-462-9608 Santa Clara Santa Clara, CA Tel: 408-961-6444 Fax: 408-961-6445 Toronto Mississauga, Ontario, Canada Tel: 905-673-0699 Fax: 905-673-6509 Australia - ... active-low byte enable signal is required Address /Data Multiplex mode: #define AddressDataNoMux #define LowAddressDataMux #define FullAddressDataMux Keep the required macro uncommented and comment ... Read PMP Data (Dummy Read) Is PMP Busy? Yes No Read PMP Data Return Read High © 2008 Microchip Technology Inc DS0121 0A- page 27 AN1210 MemBulkRead API The API MemBulkRead reads a sequence of a...
- 34
- 162
- 0
Tài liệu Module 3: Using a Conceptual Design for Data Requirements docx
... the solution’s overall data design If a solution has no data requirements, it has no need for data storage, let alone a logical data organization Determining the functional data requirements from ... The logical and physical implementation of a database necessitates that the data requirements be defined What types of data (at a high level) are going to be stored? " Explicit The data requirements ... Designing Data Services and Data Models Module 3: Using a Conceptual Design for Data Requirements Module 4: Deriving a Logical Data Design Module 6: Deriving a Physical Data Design Module 5: Normalizing...
- 20
- 580
- 0
Tài liệu Executing a SQL Server Stored Procedure By Using ActiveX Data Objects doc
... cmd.CreateParameter("CustomerID", ADODB.DataTypeEnum.adChar, ADODB.ParameterDirectionEnum.adParamInput, 5) cmd.Parameters.Append(prm) prm.Value = "CHOPS" OpenNorthwindADOConnection(cnn) cmd.ActiveConnection ... txtResults.Text = rstCurr.GetString Catch excp As Exception MessageBox.Show(excp.Message) End Try End Sub The last thing that this routine does is open a recordset based on the Command object This is to the ... object This is to the use just those records that are needed In this case, the GetString method is used to assign it to the results text box If you are using a bulk query, shown in the next section,...
- 2
- 450
- 0
Tài liệu Using the Data Form Wizard to Create a Windows Form phần 1 pdf
... the DataSet object you want to use in your form You can pick an existing DataSet, or you can create a new one Because this is a new project, you'll be creating a new DataSet Enter myDataSet as ... the Name of the form as MyDataForm.cs, and click Open (see Figure 6.18) You'll then see the welcome page for the Data Form Wizard Figure 6.18: Adding a data form using the Data Form Wizard Click ... use the Data Form Wizard to create a form that accesses the Customers and Orders tables in the Northwind database: Select Project ➣ Add New Item Select Data Form Wizard from the Templates section...
- 5
- 502
- 0
Tài liệu Using the Data Form Wizard to Create a Windows Form phần 2 doc
... child table are displayed in a DataGrid control o o o o o Cancel All The Cancel All button allows you to undo any changes you've made to the current row Add The Add button allows you to add a new ... classes contained in the System .Data. OleDb namespace-even though a SQL Server database is used These objects work with any OLE DB-compliant database The code would be more efficient if the managed ... table using a process known as data binding When a control is bound to a column in a DataSet object, the value for that column is displayed in the control through the Text property in the DataBindings...
- 7
- 444
- 0
Tài liệu Instructor Notes Module 3: Using a Conceptual Design for Data Requirements pdf
... Module 3: Using a Conceptual Design for Data Requirements Activities Activity 3.1: Identifying Data- Related Use Cases and Data Requirements In this activity, students will determine data requirements, ... Many students with database backgrounds will want to think and work in the physical data model Remind them that, at this point, the work is still in the conceptual phase THIS PAGE INTENTIONALLY ... be able to: • Discuss use cases, data requirements, and requirements validation as they relate to conceptual design for data systems ! To prepare for the activity • Review the activity and anticipate...
- 4
- 447
- 0
Tài liệu Implement the Methods That Update the Database pptx
... properties, and save it to the database Then instantiate a new CCustomer instance, loading the new row into the object Make a change to that instance, and save the changes back to the database Last, load ... the changes to the database The data adapter ' will handle all calls to the Delete, Insert, and Update ' commands odaCustomers.Update(dsChanges) Catch ex As Exception ' If the update fails, communicate ... otherwise-based on the order of the datatypes in the parameter list, and not the names of the parameters In other words, you can have two overloaded methods that take an integer and a string as their parameters,...
- 11
- 292
- 0
Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf
... reader that our two algorithms are aimed at small datasets We randomly split each dataset into 10 subsets where each subset was a test set and the corresponding remaining sets were merged to a ... incorporating a probabilistic generative model. 1 Their parameters can be estimated from either labelled data, using maximum likelihood estimates, or from unlabelled data by expectation maximization2 ... boundary value b j,i-1 and modify our transition assumptions for P ROMODES H in such a way that the new algorithm applies a first-order boundary model and a second-order transition model A transition...
- 9
- 557
- 0
Methods for Measuring Cancer Disparities: Using Data Relevant to Healthy People 2010 Cancer-Related Objectives doc
... Total Non-Hispanic White Black *AI/AN = American Indian/Alaska Native * AI/AN = American Indian/Alaska Native **API = Asian/Pacific Islander ** API = Asian/Pacific Islander Source: SEER Cancer ... Diagnosis *API = Asian/Pacific Islander * API = Asian/Pacific Islander **AI/AN = American AI/AN = American Indian/Alaska Native ** Indian/Alaska Native Source: Surveillance, Epidemiology, and End ... Total White Black API* AI/AN** Other Hispanic NonNonMinority Hispanic Hispanic White *Asian/Pacific Islander * Asian/Pacific Islander **American Indian/Alaska Native ** American Indian/Alaska Native...
- 80
- 173
- 0
Báo cáo khoa học: "SITS: A Hierarchical Nonparametric Model using Speaker Identity for Topic Segmentation in Multiparty Conversations" pptx
... and Quintana, u F A (2004) Nonparametric Bayesian data analysis Statistical Science, 19(1):95–110 [Murray et al., 2005] Murray, G., Renals, S., and Carletta, J (2005) Extractive summarization of ... people are unanimous about They want their government back We can that by ridding politics of large, unregulated contributions that give special interests a seat at the table while average Americans ... Presidential Election Debates Our second dataset contains three annotated presidential debates (Boydstun et al., 2011) between Barack Obama and John McCain and a vice presidential debate between...
- 10
- 555
- 0
Báo cáo khoa học: "A Flexible Stand-Off Data Model with Query Language for Multi-Level Annotation" ppt
... (i.e span) of basedata elements (Figure 2) Normally, however, a markable is also associated with arbitrarily many user-defined attribute-value pairs (Figure 3, Figure 4) Markables can also be ... with a capital letter Markables are the carriers of the actual annotation information They can be queried by means of string matching and by means of attribute-value combinations A markable query ... can have any string value, while nominal attributes can have one of a (user-defined) closed set of possible values The data model also supports associative relations between markables: Markable...
- 4
- 348
- 0
Báo cáo khoa học: "A TRANSFER MODEL USING A TYPED FEATURE STRUCTURE REWRITING SYSTEM WITH INHERITANCE" pot
... produced after transfer, and make appropriate pragmatic decisions RELATING SURFACE AND ABSTRACT SPEECH ACTS A problem in translating dialogues is to translate adequately the speaker's communicative ... English 2a~ Aarld new PROP symbols in the translate.act, txans-speaker and trans-hearer slots [japanese: JASA [speech-act-type: #sat~EQUEST, manner: #man=DIRECT, speaker: # j-sp-J-SPEAK~ hearer: ... propositional content has (I) a lexical head, (2) a set of syntactic featur~ (such as tense-aspect-modality, determination, gender and may have (3) a set of ), dependents which are analyzed as case...
- 6
- 264
- 0
Báo cáo khoa học: "Improvement of a Whole Sentence Maximum Entropy Language Model Using Grammatical Features" potx
... YƠ The grammatical features The main goal of this paper is the incorporation of gramatical features to the WSME Grammatical information may be helpful in many aplications of computational linguistics ... grammatical information We have shown that the the use of grammatical features in a WSME model improves the performance of the model Adding grammatical features to the WSME model we have obtained a ... with coupled markov chains and applications to statistical mechanics Random Structures and Algorithms, 9:223252 A Ratnapharkhi 1998 Maximum Entropy models for natural language ambiguity resolution...
- 8
- 332
- 0
Using Oracle Clusterware to Protect A Single Instance Oracle Database 11g pot
... requirements of your database Create a new single Instance database On Node1 create a new single instance database placing all the database files inside a clustered ASM database file system You ... 'rolling patch' the database homes then it is suggested that you install local copies of the database home rather than shared Install a Clustered ASM home and create an ASM instance [optional step] ... Database mounted Database opened SQL> shutdown immediate Database closed Database dismounted ORACLE instance shut down SQL> exit Disconnected from Oracle Database 11g Enterprise Edition Release...
- 28
- 699
- 0
Báo cáo khoa học: "A Stochastic Language Model using Dependency and Its Improvement by Word Clustering" ppt
... our models, equipped with a wordbased 2-graan model for bunsetsu generation and the character-based 2-gram as an unknown word model, can return the probability for amy input, we can build a parser, ... model for bunsetsu generation and the character-based 2-gram model as an unknown word model (Mori and Yamaji, 1997) are common to the POS-based model and class-based model Their contribution ... model estimated by our clustering method is more predictive than the POS-based model and that our word clustering Table 3: Accuracy of each model language model POS-based model class-based model select...
- 7
- 352
- 0
Báo cáo khoa học: "A MODEL OF PLAN INFERENCE THAT DISTINGUISHES BETWEEN THE BELIEFS OF ACTORS AND OBSERVERS" pot
... is also possible that no discrepancy exists at all, in which ease I will say that R believes that Q's plan is valid A response such as (10) can be modeled as arising from an inferred plan that ... generation and enablement consists largely in the fact that, when an act a generates an act ~, the agent need only a, and will automatically be done also However, when a enables the generation ... if part of her belief that Q has some plausible eplan is a belief that Q intends to some act a and R has reason to believe that Q believes that act-type conditionally generates act-type a under...
- 8
- 232
- 0
Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx
... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...
- 10
- 541
- 0
báo cáo hóa học:" Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pdf
... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...
- 10
- 401
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008