methods of circulating tumor cells ctc measurements
Báo cáo sinh học: " Negative enrichment by immunomagnetic nanobeads for unbiased characterization of circulating tumor cells from peripheral blood of cancer patients" pptx
... generation of cells with properties of stem cells, and to the ability of tumor cells to enter the circulation and seed metastases EpCAM-CK double positive CTC might represent only a subpopulation of ... combination of the both methods, in comparison to sole CD45 depletion However, the purity remained in the order of 1% with all three methods To evaluate the specificity of the methods presence of EpCAM+CK+CD45-, ... EpCAM+CK- cells (0/15), whereas we observed presence of EpCAM-CK+ cells in sample (1/15 = 7%) Flow Cytometry Linearity of CTC enrichment by CD45 depletion After enrichment for CTCs, cells were...
- 8
- 510
- 0
báo cáo hóa học:" Negative enrichment by immunomagnetic nanobeads for unbiased characterization of circulating tumor cells from peripheral blood of cancer patients" docx
... generation of cells with properties of stem cells, and to the ability of tumor cells to enter the circulation and seed metastases EpCAM-CK double positive CTC might represent only a subpopulation of ... combination of the both methods, in comparison to sole CD45 depletion However, the purity remained in the order of 1% with all three methods To evaluate the specificity of the methods presence of EpCAM+CK+CD45-, ... EpCAM+CK- cells (0/15), whereas we observed presence of EpCAM-CK+ cells in sample (1/15 = 7%) Flow Cytometry Linearity of CTC enrichment by CD45 depletion After enrichment for CTCs, cells were...
- 8
- 533
- 0
báo cáo khoa học: "Low-level expression of HER2 and CK19 in normal peripheral blood mononuclear cells: relevance for detection of circulating tumor cells" doc
... of Hematology & Oncology 2008, 1:2 http://www.jhoonline.org/content/1/1/2 Background Materials and methods The presence of circulating tumor cells (CTC) in peripheral blood and disseminated tumor ... More effort should be invested in optimizing these methods List of abbreviations CTC: Circulating tumor cells; PBMC: Peripheral blood mononuclear cells; CK19: Cytokeratin; B2M: Beta microglobulin; ... Understanding the biology of the background expression of tumor markers will be instrumental in development of more specific methods to detect CTC Isolation of PBMC from Whole Blood Blood was collected...
- 10
- 335
- 0
báo cáo hóa học:" Increased immunogenicity of surviving tumor cells enables cooperation between liposomal doxorubicin and IL-18" ppt
... subpopulations of immune cells of the adaptive and innate immune system It activates effector T cells; induces IFN-γ, TNF-α, IL-1α, and GM-CSF production; promotes Th1 differentiation of naive T cells; ... Institutional Review Board of the University of Pennsylvania Tumor inoculation For intraperitoneal (i.p.) tumors, ID8-Vegf cells were injected at × 106 per mouse For subcutaneous (s.c.) tumors, a single ... sensitize tumor to immune effector cells [18] To assess the capacity of Doxil to sensitize ovarian cancer cells to immune attack, we identified doses of Doxil in vitro at which greater than 50% of ID8...
- 9
- 468
- 0
Báo cáo y học: "Reduced number and impaired function of circulating progenitor cells in patients with systemic lupus erythematosus" pot
... lower numbers of cells after 14 days of culture (data not shown) The number of circulating CD14+ cells was reduced in SLE patients, although less pronounced than the number of circulating CD34– ... hematopoietic progenitor cells, but not on mature endothelial cells [19,21] During maturation of these cells, the expression of CD133 is lost The combined expression of CD34 and CD133, therefore, ... and CD133, therefore, defines a population of (immature) circulating progenitor cells Because of the low number of CD34 and CD133 (double-)positive cells in the peripheral blood, we chose to...
- 10
- 449
- 0
Báo cáo y học: "Clock mutation affects circadian regulation of circulating blood cells" pot
... nature of this regulation has prevented elucidation of the underlying mechanisms of circadian changes in circulating blood cells [2] The present study found that a homozygous mutation of the ... peripheral circulating redblood cells CircadianClock mutant mice Circadian variations in peripheral circulating redblood cells (RBC) in Clock mutant mice (A) Number of RBC and (B) blood levels of hemoglobin ... Circadian variations in peripheral circulatingleukocytes in Clock mutant mice (A) Total number of white blood cells (WBC), (B) number of lymphocytes, (C) number of neutrophils Open and filled circles,...
- 7
- 342
- 0
báo cáo khoa học: "Identification of circulating tumour cells in early stage breast cancer patients using multi marker immunobead RT-PCR" doc
... Primer name GenBank Accession Number Sequence 5' – 3' ELF3 s AF016295 CTCGGAGCTCCCACTCCTCAGA ELF3 as EPHB4 s GCTCTTCTTGCCCTCGAGACAGT AB209644 EPHB4 as EGFR s AB209442 TACSTD1 as MGB1 s MGB1 as ... by RT-PCR for the panel of markers Seeding dilutions of MDAMB453 into normal blood resulted in consistent detection of all RT-PCR markers at a level of 10 cells per ml of blood (Figure 1) In samples ... per ml of blood (10 cells total), marker expression was detected in 2/3 samples indicating some loss of cells during the immunobead isolation In the main part of this study, the expression of the...
- 11
- 338
- 0
Báo cáo khoa học: Enzymatic features of the glucose metabolism in tumor cells ppt
... normal cells as well as in tumor cells However, in tumor cells the importance of the objectives and thus their relative share in total glucose utilization varies during different stages of tumor ... regulation of this enzyme in tumor cells According to a proteome analysis of human liver tumor tissue there is no evidence for a significant tumor- related change of the protein level of this enzyme ... capable of reducing the level of fructose 2,6-P2 independent of the phosphorylation state of iPFK-2 Reducing the level of fructose 2,6-P2 and thus the activity of PFK-1 improves the supply of glucose...
- 24
- 454
- 0
Báo cáo khoa học: Structure and function of human a-lactalbumin made lethal to tumor cells (HAMLET)-type complexes pptx
... differentiated cells tested so far have been resistant to HAMLET’s lethal effects In tumor cells, HAMLET enters the cytoplasm of tumor cells and accumulates in the nuclei [2,30,41,42] Healthy cells, ... kill tumor cells regardless of their Bcl-2 and p53 status [50] This is consistent with apoptosis being a cellular response, but not the cause of death HAMLET-treated tumor cells also show signs of ... shedding of dead tumor cells, as determined by Trypan blue exclusion and the cells showed signs of apoptosis (Fig 3) At surgery, a reduction in tumor size was observed in six patients and four of the...
- 12
- 525
- 0
Báo cáo khoa học: Altered expression of tumor protein D52 regulates apoptosis and migration of prostate cancer cells potx
... proliferation rate of LNCaP cells First, we studied whether overexpression or downregulation of TPD52 influences the proliferation rate of LNCaP cells To determine the effect of TPD52 expression ... downregulation of TPD52 in LNCaP cells MTT assays showed a significantly increased proliferation of the PCA cell line LNCaP after transient overexpression of EGFPTPD52 (Fig 3A) The proliferation of these cells ... LNCaP cells (Fig 4G) In 30% of the TPD52 knockdown cells, a significant decrease of Dwm (P £ 0.0013) could be observed, whereas nontransfected or mock transfected cells were less than 10% of the...
- 11
- 444
- 0
Báo cáo khoa học: Determining and understanding the control of glycolysis in fast-growth tumor cells Flux control by an over-expressed but strongly product-inhibited hexokinase pdf
... 1985 ´ndez et al ´ A Marın-Herna Control of glycolysis in tumor cells Cell extracts of tumor and liver cells )1 Determination of flux control coefficients Cells (65 mg proteinÆmL ) were resuspended ... 2006 FEBS ´ ´ A Marın-Hernandez et al Control of glycolysis in tumor cells Table Maximal activity of glycolytic enzymes in hepatocytes and tumor cells AS-30D, HeLa and hepatocytes (65 mg proteinÆmL)1) ... both tumor cell types, being negligible in AS-30D cells The difference between the rates of lactate formation with and withTable Glycolysis in hepatocytes and tumor cells AS-30D and HeLa cells...
- 14
- 510
- 0
Báo cáo hóa học: " Nutraceutical augmentation of circulating endothelial progenitor cells and hematopoietic stem cells in human subjects" potx
... of cells counted cells being 30,000 per sample The percentage of CD133 and CD34 positive cells was calculated based on the measured number of leukocytes (CD45-positive cells) Quantification of ... Chandler AZ), was capable of increasing the number of circulating stem cells and progenitor cells This proprietary food supplement is produced by fermentation of a combination of green tea, astralagus, ... circumscribed by spindle shaped cells and were counted by microscope As the number of colonies depends on the number of plated cells, normalization of colony number based amount of cells plated was performed...
- 10
- 665
- 0
Báo cáo sinh học: "Functional characterization of human Cd33+ And Cd11b+ myeloid-derived suppressor cell subsets induced from peripheral blood mononuclear cells co-cultured with a diverse set of human tumor cell lines" docx
... unique profile of factors secreted by the tumor [16,17,20] Preclinical models of human tumor- induced MDSC will significantly advance knowledge of their induction and function as suppressor cells ... subsets of MDSC have been identified that will help elucidate the role of these cells in the ontogeny, spread, and treatment of cancer Page of 20 Methods Cell Lines and Cell Culture Tumor cell ... function of tumor- educated myeloid cells was measured by their ability to inhibit the proliferation of autologous T cells in the following Suppression Assay: T cells isolated from 30 mL of PBMC...
- 20
- 575
- 0
Báo cáo sinh học: "CGB and GNRH1 expression analysis as a method of tumor cells metastatic spread detection in patients with gynecological malignances" potx
... presence of tumor cells circulating in peripheral blood of gynecological cancer patients Thus, the expression of CGB and GNRH1 may become a prognostic factor of metastatic spread of tumor cells ... specificity of the genes activity as an informative way to identify tumor cells of gynecological origin in blood of cancer patients, which can indicate metastatic spread of tumor cells These ... role of circulating tumor cells in metastatic spread of carcinomas has already been very well documented However the biology of these cells is poorly understood and the clinical relevance of their...
- 9
- 460
- 0
báo cáo hóa học:" Neuronal transcription factor Brn-3a(l) is over expressed in high-grade ovarian carcinomas and tumor cells from ascites of patients with advanced-stage ovarian cancer" ppt
... Enhanced expression of Brn-3a(l) in stromal cells of high grade tumors may contribute to the metastatic ability of tumors cells as demonstrated by the tumor growth enhancing effects of cancer associated ... and perfectly round cells Fibroblasts were long elongated cells whereas tumor cells were large with visible nuclei In many cases, large multinucleated tumor cells were visible Tumor cell cultures ... lines as well as tumor cells isolated from ascites of advancedstage cancer patients Immunofluorescence analyses Immunofluorescence study was performed to determine the differences of Brn-3a expression...
- 12
- 267
- 0
Báo cáo y học: "Prevalence, clinical relevance and characterization of circulating cytotoxic CD4+CD28– T cells in ankylosing spondylitis" ppt
... distribution of the frequencies of CD4+CD28– T cells (Fig 1b) The cutoff value determined at the intersection of the two bimodal distribution curves was 1.7% Using this cutoff value, 70.3% of the AS ... transformation of percentages of CD3+CD4+CD28– T cells was performed to detect different populations of CD4+ T cells and to correct for data skewing We found a bimodal distribution of frequencies of CD3+CD4+CD28– ... specificity Levels of CD3+CD4+CD28– T cells in patients with ankylosing spondylitis and healthy control individuals (a) Accumulation of CD3+CD4+CD28– cells in peripheral blood mononuclear cells of 95 patients...
- 9
- 361
- 0
Báo cáo khoa học: "Analysis of limb function after various reconstruction methods according to tumor location following resection of pediatric malignant bone tumors" doc
... resection of the tumor Partial skin necrosis occurred postoperatively at the insertion site of one of the pins In Case 8, the Page of skin became partially necrotic at the frontal aspect of the ... the invasion of tumor cells up to the epiphyseal plate in 21 of the 25 patients [33-37] When minimal surgery is performed, the surgical procedure must be designed carefully Methods of assessing ... selection of reconstruction methods similar to those for Type II, and new diagnostic imaging techniques for the evaluation of the effects of such methods Additional material Additional file Details of...
- 7
- 312
- 0
Báo cáo y học: "B cell-activating factor of the tumor necrosis factor family (BAFF) is expressed under stimulation by interferon in salivary gland epithelial cells in primary Sjögren''''s syndrome" ppt
... origin of these cells (Figure 2a– c) Moreover, complementary staining with MPO, CD20, CD3, CD45 and smooth muscle actin excluded the possibility of contamination with myeloid cells, B cells, T cells ... with RA [45] Our results agree with findings of the absence of a major role of TNF-α in the pathogenesis of pSS, as illustrated by the lack of efficacy of TNF-α blockers in this disease [48] However, ... capacity of SGECs to express and secrete BAFF after stimulation by IFN This peculiar property of epithelial cells is enhanced in patients with pSS and confirms the importance of resident cells of target...
- 9
- 356
- 0
Delivery of chemotherapeutic agents using drug-loaded irradiated tumor cells to treat murine ovarian tumors doc
... concentrations of doxorubicin, the numbers of viable Figure Characterization of doxorubicin treatment of tumor cells MOSEC or MOSEC/luc tumor cells (1 × 106) were cultured in the presence of different ... incubation of MOSEC cells with doxorubicin led to the intracellular uptake of the drug and the eventual death of the tumor cells We also found that drugloaded tumor cells were capable of transferring ... translocation of calreticulin (CRT) to the cell surface and result in improved processing of tumor cells by dendritic cells [23] Thus, the expression of CRT on the surface of tumor cells mediated...
- 12
- 166
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25