metabolic ionic and electrophysiological alterations occurring after coronary artery occlusion and their role in t

Tài liệu Báo cáo khoa học: The small heat shock proteins and their role in human disease pptx

Tài liệu Báo cáo khoa học: The small heat shock proteins and their role in human disease pptx

Ngày tải lên : 19/02/2014, 18:20
... opaque with age and contain many inclusion bodies reactive with antibody to aB-crystallin, but not to b- and c-crystallin, suggesting an important role for aA-crystallin in maintaining lens transparency ... GJS, Hutcheson AM, Clark JI & Quinlan RA (1999) The cardiomyopathy and lens cataract mutation in aB-crystallin alters its protein structure, chaperone activity, and interaction with intermediate ... a-crystallin chaperone activity and packing, magnifying the consequences of these changes and promoting cataract formation more than anticipated Evidence linking cataract and a-crystallin post-translational...
  • 15
  • 573
  • 0
Aggregate bankruptcy probabilities and their role in explaining banks’ loan losses doc

Aggregate bankruptcy probabilities and their role in explaining banks’ loan losses doc

Ngày tải lên : 22/03/2014, 20:21
... registered in the corresponding industries and counties, and submitting financial statements according to the SEBRA-database At the same time, a closer accord between the two statistics is obtained ... of industry/county/year groups, i.e joining or excluding some counties; Interpolating accounting data, and thus obtain estimated and predicted bankruptcy probabilities without gaps; Interpolating ... observations After the first examination, it turned out that some of the industries contain a very large random part, i.e close to 100% To avoid this, industries Transport and storage (code 911) and...
  • 47
  • 243
  • 0
Báo cáo khoa học: Arthropod nuclear receptors and their role in molting pptx

Báo cáo khoa học: Arthropod nuclear receptors and their role in molting pptx

Ngày tải lên : 23/03/2014, 04:20
... restricted to the retina and plays a critical role in the development of photoreceptors Both TLL and PNR play important roles during vertebrate eye development According to Laudet and Bonneton, ... If it is ingested, its potency also depends on the amount of ingested ecdysteroids, its ability to pass through the gut wall and its rate of inactivation The binding affinities of representative ... DNA-binding proteins (transcription factors) are components of genetic switches that turn genes ‘on’ or ‘off’ at the right time and place in the body The binding of transcription factors to the...
  • 30
  • 611
  • 0
báo cáo hóa học:" RAGE (Receptor for Advanced Glycation Endproducts), RAGE Ligands, and their role in Cancer and Inflammation" pptx

báo cáo hóa học:" RAGE (Receptor for Advanced Glycation Endproducts), RAGE Ligands, and their role in Cancer and Inflammation" pptx

Ngày tải lên : 18/06/2014, 15:20
... acid alterations in the two Ca++ binding domains that lock the structure into an active state independently of calcium concentration [109] It will form a heterotetramer with Annexin A2, and it has ... important to inhibit RAGE activation and, in the setting of cancer, tumorigenesis RAGE is the link between inflammatory pathways and pathways promoting tumorigenesis and metastasis Characterizing ... first two vicinal cysteines (Cys 23 and 45, based on Met1 as the initial Met in the immature protein) can form an internal disulfide bond within the Abox The A-box and the oxidation state of these...
  • 21
  • 626
  • 0
báo cáo khoa học: "A Review of Metallothionein Isoforms and their Role in Pathophysiology" ppsx

báo cáo khoa học: "A Review of Metallothionein Isoforms and their Role in Pathophysiology" ppsx

Ngày tải lên : 09/08/2014, 01:24
... primarily in the brain and functions as a growth inhibitory factor in the brain MTIII is located primarily in the central nervous system with small amounts present in the pancreas and intestines It plays ... can bind with both essential metals (zinc and copper) and toxic metals (cadmium and mercury) in two distinct cluster structures within the molecule One cluster is closer to the N-terminal and three ... Growth Retardation and MT Isomers Bone growth retardation, zinc and its binding protein MT are important in regulating growth and development of bone A study on relationship between dietary Zn and...
  • 7
  • 343
  • 0
báo cáo khoa học: " Expression of Ets-1, Ang-2 and maspin in ovarian cancer and their role in tumor angiogenesis" pps

báo cáo khoa học: " Expression of Ets-1, Ang-2 and maspin in ovarian cancer and their role in tumor angiogenesis" pps

Ngày tải lên : 10/08/2014, 10:21
... proteins in different parts of tissue samples Its major disadvantage is that it is impossible to show that the staining corresponds with the protein of interest as in the case of immunoblotting ... previous studies The mechanisms underlying the localization of maspin and its interaction with Ets-1 warrant further investigations In this study we employed IHC to evaluate the expression of Ets-1, ... percentage of the cells stained In addition, staining intensity was scored as (negative), 1+ (weak), 2+ (medium), and 3+ (strong) A combined score based on the staining intensity and the percentage of...
  • 6
  • 230
  • 0
Báo cáo y học: " T4 genes in the marine ecosystem: studies of the T4-like cyanophages and their role in marine ecology" doc

Báo cáo y học: " T4 genes in the marine ecosystem: studies of the T4-like cyanophages and their role in marine ecology" doc

Ngày tải lên : 12/08/2014, 02:20
... proposed they also act to maintain the function of the host photosystem during infection [11] Whilst psbA and psbD are the most studied genes that may alter photosynthetic ability, they are certainly ... circumstances Page 11 of 19 the phage find it self within its host with alternative modes leading to an increase in the production ATP and NADPH [23] It does appear that maintaining or altering ... light intensities This suggests an alternative flow of electrons to receptors other than CO2 and the most likely candidate acceptor is PTOX [73] The alternative electron flow eases the excitation...
  • 19
  • 524
  • 0
Báo cáo y học: " Oxygen-regulated transcription factors and their role in pulmonary disease" pptx

Báo cáo y học: " Oxygen-regulated transcription factors and their role in pulmonary disease" pptx

Ngày tải lên : 12/08/2014, 18:20
... hypoxia activates protein kinase C-β activity in mononuclear phagocytes is unknown but this activity seems to be crucial for the induction of EGR-1 activity and tissue factor production EGR-1 ... below), indicating that hypoxia induces tissue factor expression by two different mechanisms that both involve EGR-1 Thus, in contrast to NF-IL6, hypoxia-induced EGR-1 activity promotes pulmonary ... luminal diameter One determinant of vascular tone is the production by ECs of ET-1, a potent SMC vasoconstrictor The activity of voltage-gated potassium (KV) channels is another important determinant...
  • 4
  • 302
  • 0
Báo cáo y học: " Bench-to-bedside review: Toll-like receptors and their role in septic shock" pps

Báo cáo y học: " Bench-to-bedside review: Toll-like receptors and their role in septic shock" pps

Ngày tải lên : 12/08/2014, 18:21
... development of small molecules that interfere with the intracellular domains of the TLRs This approach could prevent interaction with distal intracellular signaling molecules after ligand binding to TLRs ... been shown to have the binding specificity to discriminate LPS from host lipids The interest in TLR biology increased greatly as evidence accumulated that these proteins participate in intracellular ... homolog to evolutionarily conserved signaling intermediate in Toll pathways (ECSIT) Transfection of dECSIT in insect cells leads to production of diptericin, attacin and defensin (antimicrobial peptides)...
  • 12
  • 247
  • 0
Báo cáo y học: "Psychosocial factors and their role in chronic pain: A brief review of development and current stat" ppsx

Báo cáo y học: "Psychosocial factors and their role in chronic pain: A brief review of development and current stat" ppsx

Ngày tải lên : 13/08/2014, 13:22
... the central and dominant influencing psychological factors in the assessment for identification and intervention strategies Competing interests The author(s) declare that they have no competing ... resting, are effective in allowing the healing process to occur [24] In chronic pain patients, the pain and disability appear to persist beyond the expected healing time for such a complaint The ... amalgamated the Cognitive and behavioural thinking and proffered the closest structure yet to such a model It has sought to incorporate many of these factors, and as such offers a structure from...
  • 5
  • 355
  • 0
Bees and their role in forest livelihoods A guide to the services provided by bees and the sustainable harvesting, processing and marketing of their products

Bees and their role in forest livelihoods A guide to the services provided by bees and the sustainable harvesting, processing and marketing of their products

Ngày tải lên : 03/06/2015, 08:41
... which they distribute to attract other males – who the same and multiply the effect with a scented cloud, in the end so strong, that it attracts female bees so that mating can take place During the ... forest – dwelling people to harvest products that can be of world quality In working to retain natural environments, it is widely understood that habitats cannot be protected without the interest ... resistant to medicines developed for their treatment, and research is underway in many countries to find better, integrated control methods, or resistant strains of bees Recently another predator,...
  • 204
  • 383
  • 0
HCV functional genomic  protein interactions with NS3 and their role in viral replication

HCV functional genomic protein interactions with NS3 and their role in viral replication

Ngày tải lên : 16/09/2015, 17:12
... (CGCGGATCCATGGCGCTACTAGATGTATGC) which contained a BamHI site, and OLG 145 (CCGCTCGAGTTATTGATTGGCTTCCCGGTA) which contained a XhoI site Vectors, plasmids used in studying NS3-NS3 interaction and ... interaction, other parts of the NS3 protein may also contribute to the stability of NS3-NS3 interaction Deletion of the protease domain and the C-terminal half of the NS3 protein containing the ... interacted well with the helicase domain and with itself, but not with the C-terminal two-thirds of the helicase domain The C-terminal two-third did not interact with the helicase domain 30 flag-min+myc-min...
  • 105
  • 280
  • 0
Effect of muscarinic agents on sclera fibroblast and their role in myopia 1

Effect of muscarinic agents on sclera fibroblast and their role in myopia 1

Ngày tải lên : 17/09/2015, 17:20
... permeabilisation of the cells and incubation with TdT and biotinylated nucleotide followed by the detection of the incorporated biotinylated nucleotide with streptavidin-HRP conjugate and substrate (DAB) ... biotinylated gelatinase substrates for 30min at 37°C, allowing the MMP-2 present in the sample to cleave biotinylated substrates Uncleaved (remaining) substrates were then added to a biotin binding ... before they were treated with growth factors or muscarinic agents BrdU was added to the fibroblast culture at the same time as the test agent, to be incorporated into newly synthesized DNA After...
  • 159
  • 253
  • 0
Effect of muscarinic agents on sclera fibroblast and their role in myopia

Effect of muscarinic agents on sclera fibroblast and their role in myopia

Ngày tải lên : 17/09/2015, 17:20
... Effect of atropine inhibiting SF cell proliferation in culture Chick SF were incubated with atropine Phase contrast photomicrographs were taken after 24 hrs (magnification x100) A Control culture ... sclera protein extract Land 3: MMP-9 standard Diagram Mechanism of growth factor action and related events Diagram Interaction between muscarinic and EGF receptors in growth regulation Diagram ... slides and incubated with atropine (0.1-100 µM) TUNNEL assay was performed after 24 hrs and photomicrographs are taken (magnification x100) Positive control (control culture stimulated to undergo...
  • 9
  • 238
  • 0
Báo cáo khoa học: "The metabolic and renal effects of adrenaline and milrinone in patients with myocardial dysfunction after coronary artery bypass graftin" pdf

Báo cáo khoa học: "The metabolic and renal effects of adrenaline and milrinone in patients with myocardial dysfunction after coronary artery bypass graftin" pdf

Ngày tải lên : 13/08/2014, 03:21
... coordinating the study and in the interpretation of data and were involved in drafting the manuscript JP was involved in the interpretation of the data and revised the manuscript for important intellectual ... lactate in patients with sepsis during treatment with adrenaline The authors showed that patients with septic shock had increased skeletal muscle lactate production and that these metabolic alterations ... inotropic support after cardiac surgery – in contrast to treatment with the PDE-III inhibitor milrinone – is associated with unwarranted metabolic and detrimental renal effects In line with observational...
  • 10
  • 363
  • 0
Báo cáo y học: "Estimation of lung vital capacity before and after coronary artery bypass grafting surgery: a comparison of incentive spirometer and ventilometry" pps

Báo cáo y học: "Estimation of lung vital capacity before and after coronary artery bypass grafting surgery: a comparison of incentive spirometer and ventilometry" pps

Ngày tải lên : 10/08/2014, 09:21
... circulation time higher than 150 minutes, intolerance and/ or difficulties in understanding the technique were excluded This protocol was approved by the Ethical Committee of our institution All patients ... patients in pre operatory (15 men) and 32 patients in post operatory (21 men) (table 1) In table averages and DVC standard deviation patterns accomplished through ventilometry and spirometry in ... study was to evaluate the incentive spirometers as a method of assessment VC in patients in pre and post coronary artery bypass grafting (CABG) surgery Methods Studied population This study was...
  • 5
  • 342
  • 0
Báo cáo y học: "Thrombotic gene polymorphisms and postoperative outcome after coronary artery bypass graft surgery" ppt

Báo cáo y học: "Thrombotic gene polymorphisms and postoperative outcome after coronary artery bypass graft surgery" ppt

Ngày tải lên : 10/08/2014, 09:22
... was instituted at a flow rate of 2.4 L/min/m2 after systemic heparin administration (1 mg/kg) During CPB, the mean arterial pressure target was set at 60 mm Hg, and the core temperature of the ... Postoperative Outcomes of Patients According Their Genotypes None of the genotypes investigated were independently associated with excess mortality Post-operative data is summarized in Table The overall ... diabetes, hypertension, and hypercholesterolemia also affect the outcomes following percutaneous coronary interventions or CABG In the present study, we investigated the genetic contribution...
  • 8
  • 311
  • 0
Báo cáo y học: "Early and mid term mortality after coronary artery bypass grafting in women depends on the surgical protocol: retrospective analysis of 3441 on- and off-pump coronary artery bypass grafting procedures" doc

Báo cáo y học: "Early and mid term mortality after coronary artery bypass grafting in women depends on the surgical protocol: retrospective analysis of 3441 on- and off-pump coronary artery bypass grafting procedures" doc

Ngày tải lên : 10/08/2014, 09:22
... revising it critically for important intellectual content; and all authors have read and given final approval of the version to be published Competing interests The authors declare that they have ... associated with better outcomes than on-pump CABG surgery Our results reflect a drastically lower mortality in woman after OPCAB The mortality rates in men and women from the retrospective study ... was to determine the gender-related mortality observed after CABG under ECC and compared to the gender-related mortality obtained after OPCAB Methods At the Cardiac Surgery Department of the Ludwig...
  • 5
  • 410
  • 0
Báo cáo y học: "Preoperative ejection fraction as a predictor of survival after coronary artery bypass grafting: comparison with a matched general population" docx

Báo cáo y học: "Preoperative ejection fraction as a predictor of survival after coronary artery bypass grafting: comparison with a matched general population" docx

Ngày tải lên : 10/08/2014, 09:22
... manuscript JS: participated in writing and revising the manuscript JtW: participated in writing the manuscript AdW: participated in writing the manuscript EM: participated in the statistical analysis ... participated in writing and revising the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests Author Details ... cohort of the Dutch citizens Patients whose EF was within normal limits had better long-term survival than that in the matched cohort of the general Dutch population Although that information...
  • 8
  • 358
  • 0
Báo cáo y học: "Daptomycin for treatment of methicillin-resistant Staphylococcus epidermidis saphenectomy wound infection after coronary artery bypass graft operation (CABG): a case repor" ppt

Báo cáo y học: "Daptomycin for treatment of methicillin-resistant Staphylococcus epidermidis saphenectomy wound infection after coronary artery bypass graft operation (CABG): a case repor" ppt

Ngày tải lên : 10/08/2014, 10:20
... in combination with Daptomycin The patient was discharged from hospital on the twenty-eighth postoperative day and was sent for further rehabilitative therapy This case describes, to the best ... in its design and coordination AFP conceived of the study, and participated in its design and coordination STS conceived of the study, and participated in its design and coordination KOC participated ... participated in the design of the study and performed the statistical analysis SAM participated in the design of the study and performed the statistical analysis AW participated in the design of the...
  • 3
  • 658
  • 0