0

md van remmen h conrad cc huang tt epstein cj richardson a 1998 increased oxidative damage is correlated to altered mitochondrial function in heterozygous manganese superoxide dismutase knockout mice j biol chem 273 28510 28515

Expression dynamics of the hepatic mitochondrial proteome of the sod2+  mouse in response to troglitazone administration

Expression dynamics of the hepatic mitochondrial proteome of the sod2+ mouse in response to troglitazone administration

Tổng hợp

... 8-hydroxydeoxyguanosine 8-oxo-hydrodeoxyguanosine Alanine aminotransferase Asparate aminotransferase Area under curve Carbonate radical anion Chromatin Immunoprecipitation Database for Annotation, Visualization ... forward is the inflammagen hypothesis (Uetrecht, 2008) This is based on a combination of drugs in doses normally tolerated and inflammagens such as liposaacharide (LPS) that lead to acute hepatic ... withdrawals Cardiotoxicity refers to heart-related toxicities other than torsades de pointes Torsades is a life-threatening arrhythmia and may present as sudden cardiac death in patients with...
  • 226
  • 1,830
  • 0
Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc

Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc

Báo cáo khoa học

... a normal interaction with APC is required It is likely that the heparin-binding loop 37 of APC interacts directly with FVa in an area adjacent to the Arg506 cleavage site and that this interaction ... identical with those obtained in the absence of heparin (data not shown) To gain insights into which rate constants (k506 and k¢306 in intact FVa and k306 in FVaint) were in uenced by heparin, two additional ... of heparin effect on FVa inactivation by APC mutants deficient in heparin binding To verify that the inhibition of APC-mediated FVa inactivation by heparin is related to the ability of heparin to...
  • 13
  • 654
  • 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Báo cáo khoa học

... 0.4 A Significant deviations for main- and side-chain atoms in the ligand loop containing the K100 are however, observed To accommodate K100 as a ligand a number of main-chain atoms are displaced ... switching is observed at alkaline pH for the M100K variant This contrasts with the unfolding data accumulated in this study which show that the early unfolding of the M100K variant involves the breaking ... ligand-exchange mechanism at alkaline pH for the M100K variant which contrasts to what occurs in the presence of the chemical denaturant GdmHCl as ascertained in this study by NMR Experimental procedures...
  • 15
  • 509
  • 0
Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx

Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx

Báo cáo khoa học

... Template PCR System The two primers used were the sense primer (5¢-ATTCTAGAAGCGGAGACCATGGCCCCTCCTC AG-3¢) and the antisense primer (5¢-ATTCTAGATAG GGTACAGGCCCTTGTGTCCCG-3¢), both bearing the XbaI ... sterols in embryonic patterning and meristem programming revealed by the fackel mutants of Arabidopsis thaliana Genes Dev 14, 1485±1497 13 Waterham, H. R & Wanders, R .J .A (2000) Biochemical and genetic ... (Eur J Biochem 269) 285 RNA isolation and Northern blot analysis Total RNA was isolated from different bovine tissues (liver, brain, lung, skeletal muscle, heart, adrenal, and testis) by homogenizing...
  • 8
  • 493
  • 0
Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel fluorescent probe pdf

Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel fluorescent probe pdf

Báo cáo khoa học

... establish the potential value of the probe for facilitating investigations of the generation, metabolism, and mechanisms of superoxide- mediated cellular homeostasis and injury pH meter (Shanghai ... 1,4-Hydroquinone was from Fluka 4,5-Dihydroxy1,3-benzenedisulfonic acid disodium salt (Tiron) was from Shanghai Reagent Co Ltd (Shanghai, China) All chemicals were of analytical reagent grade, and double-distilled ... that in which they had been grown, and disrupted for 10 in a VC 130PB ultrasonic disintegrator (Sonics & Materials Inc., Newtown, CT, USA) During sonic disruption, the temperature was maintained...
  • 9
  • 401
  • 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx

Báo cáo khoa học

... GGCAACGAGCAAGGTCCGAAG AAGTCGTTGCAATCGGCGTCG GGCAACGAGCAAGGTCCGAAG GACGTCGTGAGTGCCTCCGTG CGACGTGCAGTATTACTTTTCTAGGG AGTATCAAACCGTGCTGGTCTCC Bioinformatic analyses Sequence similarity searches ... buried amino acids, thereby maintaining the structural integrity of an N europaea CCP-similar fold of SACCP, and thus bringing the hemes in close proximity to each other in contrast to increased interheme ... CJ, Slotboom DJ, Jongejan L, Reijnders WN, Harms N, Duine JA & van Spanning RJ (1995) Mutational analysis of mau genes involved in methylamine metabolism in Paracoccus denitrificans Eur J Biochem...
  • 12
  • 392
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "PCR-based detection of genes encoding virulence determinants in Staphylococcus aureus from bovine subclinical mastitis cases" doc

Báo cáo khoa học

... :esrever TTGGCATAGTGGTAGTTAGC :drawrof TACAGCAATTTGGACCAC :esrever AAGGAGAAAACCACGAAC :drawrof CTCCTTCTGTTGTTGTTCGG :esrever GCGTCGTAAACGTCGTCCAC :drawrof CGTAGCTTGTTAGCCTTCG :esrever GGACATGGTCGTAGAGATA ... :1* *margorp RCP )pb( stcudorp deifilpma fo eziS 2401 019,017,726 079,018,095 513,352,022 972 612 AGATGTCTTGGAAGCCAATTAATG :esrever ATCGGTATTTAACTAGCCCTGAAA :drawrof CGAAATCAAGCAGTTCCGAACGCA :esrever ... noitacol pam lamosomorhc dna ecnelaverP JJ olodnaI ,DM semahT ,rJ LF ttarP ,FA ypsalliG ,SM reztlemS 61 901-301 ,5 ,4002 icS teV J ynamreG ni esseH dna aisenodnI ni avaJ lartnec ni sititsam lacinilcbus...
  • 4
  • 138
  • 0
Tài liệu Int’l High Performance Network Infrastructure of Korea doc

Tài liệu Int’l High Performance Network Infrastructure of Korea doc

Báo cáo khoa học

... Cultural Exchange Communication Experiment among C /J/ K 11 APII Testbed: Characteristics  Toward a major research network in AP region A major actor in Asia for TEIN with GEANT, European counterpart ... conducting joint R&Ds in various application services  Cooperation among APEC member economies Korea, Japan, Singapore and US are the main partners APII -CC( Korea) & APII-TC(Japan) play a leading ... of NEA & SEA GEANT UK Sweden Germany France Spain Lithuania Poland NEA Austria Romania Italy TEIN 10Mbps KOREA CHINA JAPAN 45Mbps 16-45Mbps 12Mbps MALAYSIA SEA Singapore Int’l ICT, IR, USA 1Gbps...
  • 30
  • 362
  • 0
Báo cáo khoa học: Injection of poly(b-L-malate) into the plasmodium of Physarum polycephalum shortens the cell cycle and increases the growth rate pot

Báo cáo khoa học: Injection of poly(b-L-malate) into the plasmodium of Physarum polycephalum shortens the cell cycle and increases the growth rate pot

Báo cáo khoa học

... histone H1 in cytoplasmic extracts without (m) and after incubation with Lambda protein phosphatase (j) ; one relative unit ¼ 105 · A4 90 /A5 95 (A4 90 ELISA readings, A5 95 protein readings according to ... PMLA with a delay of 1–2 h As epitopes had been masked by phosphorylation in vivo, a higher amount of H1 was detected after dephosphorylation with Lambda protein phosphatase (Fig 3C, j) Injection ... propose that the underlying mechanism by which PMLA increases the growth rate and shortens the duration of the cell cycle is the polymer-inherent isosterism of the carboxylates with the array of phosphates...
  • 7
  • 325
  • 0
Child Health And The Quality Of Medical Care by Sarah L. Barber University of California, Berkeley ppt

Child Health And The Quality Of Medical Care by Sarah L. Barber University of California, Berkeley ppt

Sức khỏe trẻ em

... Sumatra, Lampung, DKI Jakarta, West Java, Central Java, Yogyakarta, East Java, Bali, West Nusa Tenggara, South Kalimantan and South Sulawesi 12 Socio-Demographic Survey.6 Over-sampling in urban and ... practice high quality prenatal and child healthcare can directly influence the efficacy of the production of child health inasmuch as their practices have an empirical basis The major assumption, therefore, ... implication of this conceptualization is that analyses is a measure of both short- and long-term insults to health health stock is a function of past as well as current values of the constraints Thus,...
  • 53
  • 369
  • 0
Báo cáo khoa học: Novel L-amino acid oxidase with antibacterial activity against methicillin-resistant Staphylococcus aureus isolated from epidermal mucus of the flounder Platichthys stellatus pptx

Báo cáo khoa học: Novel L-amino acid oxidase with antibacterial activity against methicillin-resistant Staphylococcus aureus isolated from epidermal mucus of the flounder Platichthys stellatus pptx

Báo cáo khoa học

... nLC-Linear-Trap-TOF MS (Hitachi, Tokyo, Japan) Antiserum preparation and IgG purification An antiserum against the antibacterial protein was obtained by injecting a Japanese white rabbit (Kitayama Labes ... Mac-coated slides (Matsunami Trading Co Ltd., Osaka, Japan) Deparaffinized and rehydrated sections were stained with hematoxylin and eosin Immunohistochemical staining for antibacterial protein ... clinical isolate), E faecalis V583 (VanB+, clinical isolate) and Entero- A flounder LAAO-like antibacterial protein coccus gallinarum BM4174 (VanC1+, clinical isolate); and the gram-negative bacteria...
  • 13
  • 423
  • 0
The Project Gutenberg EBook of Creating Capital, by Frederick L. Lipman pot

The Project Gutenberg EBook of Creating Capital, by Frederick L. Lipman pot

Quản trị kinh doanh

... through the opportunity of saving from extraordinary earnings is one who is adding to the abnormal demand for such things as phonographs, jewelry, spirits, and tobacco And this helps to explain ... justifying that which in his case is the gratification of shiftless indulgence Above all, this typical individual will not accept and act upon the idea that his affairs, his small income and expenditure, ... thought backward to a time not very many years ago when all this country was a natural wilderness, we may begin to realize the magnitude of the wealth, the capital, that has come into being since...
  • 109
  • 350
  • 0
The Project Gutenberg E Book of Domestic Animals, by Richard L. Allen ppt

The Project Gutenberg E Book of Domestic Animals, by Richard L. Allen ppt

Quản trị kinh doanh

... management of lambs castrating and docking tagging or clatting Summer management and food washing shearing smearing and salving weaning drafting stall feeding—management on the prairies Diseases ... Poultry Hinny—see Ass Horse—the Arabian and Barb the English American Arabians in America Ranger, the Barb— Bussorah—Narraganset 138 139 141 139, 140 pacers—Messenger, imported Morgan horses Canadian ... enable the breeder to preserve the high character of the animals in his hands, or perhaps still farther to advance them; while proper management and feeding will prevent that deterioration and...
  • 794
  • 2,692
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Soil environment and nutrient status of Norway spruce (Picea abies [L.] Karst.) underplantings in conditions of the 8th FAZ in the Hrubý Jeseník Mts" potx

Báo cáo khoa học

... to discoloration changes in the assimilatory organs and to a reduction in the total resistance potential of plants This relationship was also demonstrated by a statistical survey when correlations ... of the stand concerned was also evaluated A scale of underplanting damage was developed according to the chosen method (I 1990) in order to compare damage in the particular localities and ... is a part of predisposition factors in uencing their poor health status MATERIAL AND METHODS Description of the area concerned and research plots The massif of the Hrubý Jeseník Mts is a tectonically...
  • 12
  • 529
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Influence of exogenous L-proline on embryogenic cultures of larch (Larix leptoeuropaea Dengler), sitka spruce (Picea sitchensis (Bong.) Carr.) and oak (Quercus robur L.) subjected to cold and salt stress" pdf

Báo cáo khoa học

... of Biology and Technology 44 (2001) 191–196 [17] Rhodes D., Handa S., Amino acid metabolism in relation to osmotic adjustment in plant cells, in: Cherry J .H (Ed.), Biochemical and Physiological ... Factorial ANOVA showed that there was a very highly significant effect of proline and temperature, and of the interaction between them (p < 0.0005), with a very highly significant effect of proline ... correspondingly low When proline is added, intracellular proline levels recorded correspond approximately to the amount of proline added to each culture DISCUSSION Exogenous proline has been shown to have...
  • 4
  • 338
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: " Influence of repeated defoliations by insects on wood increment in common oak (Quercus robur L)" pps

Báo cáo khoa học

... costs and to J Bohin and E Dreyer for help in organizing his participation in the meeting in Nancy, France the floodplain stand presenting the highest ratios and most severe decreases, and the solonetz, ... specially during early spring These stands probably displayed a defence against early damage through a quick recovery of leaf area This were more defence was probably effective only in healthy stands ... stands, and the lowest in the floodplain and riverbank stands Since the crowns are more frequently damaged by insects in floodplain stands, these latter have probably developed a defence mechanism,...
  • 6
  • 263
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A comparison of photosynthetic responses to water stress in seedlings from 3 oak species: Quercus petraea (Matt) Liebl, Q rubra L and Q cerris L" doc

Báo cáo khoa học

... Early drought effects seem to be mainly inby stomatal limitation to photosyn- duced thesis Disorders in the photosynthetic apparatus appeared, nevertheless, at higher stress intensities in all ... may be able to explain these differences in drought-induced sensitivity to photoinhibi- tion Still the higher tolerance to photoinhibition in Q cerris at a similar level of Q reA duction has to ... 1992) The reasons for this increased sensitivity to high irradiance due to drought are still open to debate One explanation may be that CO starva2 tion induced by stomatal closure allowed damaging...
  • 13
  • 402
  • 0

Xem thêm