matrix a and its transpose in terms of submatrices distributed among four ues

A study of the vietnamese translation of english non finite clauses and its application in vietnamese and english translation

A study of the vietnamese translation of english non finite clauses and its application in vietnamese and english translation

Ngày tải lên : 26/11/2013, 13:19
... textual material in one language (Source language) by equivalent an infinitive, a present participle or a past participle and gerund material in another language (Target Language)” According to ... What are the implications on teaching, learning and – finite Clauses and Its Application in Vietnamese English translating non – finite clauses? Translation” 1.5 ORGANIZATION OF THE STUDY 1.2 AIMS ... discussion of finding is carried out in order to find out the ways of translating of non – finite clauses Finally, giving some implications on teaching, learning and translating non – finite clauses...
  • 13
  • 1K
  • 3
A study of modality expressed in terms of grammaticalization and lexicalization in english and vietnamese

A study of modality expressed in terms of grammaticalization and lexicalization in english and vietnamese

Ngày tải lên : 26/11/2013, 13:21
... Lehmann (1995) [57], “lexicalization and grammaticalization are processes that have much in common and are, to a certain parallel The mirror image of grammaticalization is degrammaticalization, and ... that lexicalization and grammaticalization are not at all contradictory processes The study initially suggests some ways of analyzing modal verbs in terms of lexicalization and grammaticalization; ... adjectives and Aspect + Modal adverbs + Modal nouns b A modality analysis can be made with the combination of lexicalization and grammaticalization, and through the change of tense (can- could) and aspect...
  • 23
  • 1.1K
  • 3
A study of the english translational versions of tring cong son's songs in terms of semantic and syntactic features

A study of the english translational versions of tring cong son's songs in terms of semantic and syntactic features

Ngày tải lên : 26/11/2013, 13:23
... provide insights into the practice of translating Vietnamese songs into English, especially the strategies in handling the intricacies of semantic and syntactic features of great works such as those ... Translation by cultural substitution - Translation by using a loan word or loan word plus explanation - Translation by paraphrase using a related word - Translation by paraphrase using unrelated ... sentences by taking Trinh Cong Son’s songs as the data 9 10 - Describing and analyzing the collected data to find out the semantic features of lexicon and syntactic features of phrases and sentences...
  • 13
  • 708
  • 1
A discourse analysis of advertisements in terms of persuasion strategies in english and vietnamese

A discourse analysis of advertisements in terms of persuasion strategies in english and vietnamese

Ngày tải lên : 26/11/2013, 13:29
... adjectives and superlative adjectives The evaluative similarities between EAs and VAs adjectives appear in all six persuasive strategies “Make messages In terms of the layout features, both EAs and VAs ... (130 in English and 130 in Vietnamese) are randomly taken and classified into two model of persuasion – Alpha strategies and Omega strategies Then, the distinctive features of English and Vietnamese ... learners in advertisements in terms of lexical choice, syntax and pragmatics in particular Therefore, A discourse analysis of advertisements in English and Vietnamese? terms of persuasion strategies...
  • 13
  • 1.1K
  • 2
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

Ngày tải lên : 18/02/2014, 18:20
... used were: 5¢-CAGCAATTGTCACACATCAAGAA-3¢ (sense) and 5¢-T-ACATGTAGGTATGAAGACATCGTC T-3¢ (antisense) for exon 9; 5¢-TCCCTGCTTCCTCTGGC GGA-3¢ (sense) and 5¢-AGCCATAGCCATAGCCACTTC C-3¢ (antisense) for ... 5¢-CGGTTCAGGTACTCAGT CATCCA-3¢ (antisense) for Bcl-2; and 5¢-ACGGGAGAT GACAATGGAGAAAT-3¢ (sense) and 5¢-CATGGGTAG CAGCTCCTTCTTC-3¢ (antisense) for Apaf-1 Total RNA was extracted from cultured cells using ... (Applied Biosystems) Primers for methylated DNA were: 5¢-AAGTAGGCGGAGTATCGAAC-3¢ (sense) and 5¢-GAAAAAACGCGATCCTACTT-3¢ (antisense) Primers for unmethylated DNA were: 5¢-GAAGTAGGTGGAGT ATTGAAT-3¢...
  • 12
  • 613
  • 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Ngày tải lên : 07/03/2014, 21:20
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and ... Vpr was fused in- frame with a Gal4 DNA-binding domain and used as bait in the yeast expression vector pGBT9 The GAL-4 activation domain tagged brain cDNA library (gift from Dr Srinivasan, Thomas...
  • 12
  • 561
  • 0
Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf

Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf

Ngày tải lên : 16/03/2014, 06:20
... (forward, 5¢-AAG GCT TAC CAC GAG CAG CTA TCA-3¢; reverse, 5¢-ACA GGC CAT GTA CTT TCC GTG TCT-3¢) and tobacco (forward, 5¢-ATG AGA GAG TGC ATA TCG AT-3¢; reverse, 5¢-TTC ACT GAA GGT GTT GAA-3¢) a- tubulinspecific ... collected at 0.2 °C intervals The starting amount of the AtZFP11 transcript in each sample was calculated using a standard curve (logarithm of the starting quantity versus threshold cycle) generated ... plants, the average starting quantity of AtZFP11 was normalized to the average starting quantity of the a- tubulin gene, which is assumed to be at a constant levels in all the samples The Arabidopsis...
  • 16
  • 454
  • 0
Báo cáo khoa học: Characterization of Trypanosoma brucei PEX14 and its role in the import of glycosomal matrix proteins pptx

Báo cáo khoa học: Characterization of Trypanosoma brucei PEX14 and its role in the import of glycosomal matrix proteins pptx

Ngày tải lên : 23/03/2014, 17:21
... that an intact glycosomal membrane and proper enzyme compartmentation are of vital importance for these cells to compensate for a lack of activity regulation of hexokinase and phosphofructokinase ... behaves as an integral peroxisomal membrane protein in Hansenula polymorpha [19] and humans [17] and as a tightly bound peripheral peroxisomal membrane protein exposed to the cytosol in Saccharomyces ... cerevisiae [15] However, no membrane-spanning domains in PEX14 have been unambiguously identified and it was observed in mammalian cells and S cerevisiae that both the N-terminal and the C-terminal...
  • 9
  • 549
  • 0
Báo cáo khoa học: "METONYMY: REASSESSMENT, SURVEY OF ACCEPTABILITY, AND ITS TREATMENT IN A MACHINE TRANSLATION SYSTEM S" ppt

Báo cáo khoa học: "METONYMY: REASSESSMENT, SURVEY OF ACCEPTABILITY, AND ITS TREATMENT IN A MACHINE TRANSLATION SYSTEM S" ppt

Ngày tải lên : 23/03/2014, 20:20
... Metonymic interpretation and associative processes in natural language In Exxon has raised its price again Washington is insensitive to the needs of the people Language and Artificial Intelligence, Makoto ... Shin-ichiro and Wakao, Takahiro (1992) Metonymy: reassessment, survey of acceptability, and its treatment in a machine translation system Locating 1.1 Container for Content Dave drank the glasses The ... details, Kamei and Wakao 1992) Based on both intuitive analyses and the result of the survey, we have esta, blished four major patterns, and several sub-groups for the first pattern (Locating) as...
  • 3
  • 453
  • 0
A BRIEF REVIEW OF CREATIVE ACCOUNTING LITERATURE AND ITS CONSEQUENCES IN PRACTICE pptx

A BRIEF REVIEW OF CREATIVE ACCOUNTING LITERATURE AND ITS CONSEQUENCES IN PRACTICE pptx

Ngày tải lên : 29/03/2014, 14:20
... Within the limits of laws and standards Return: Earnings per share (EPS) Fraud Main research streams Name of the research stream Main objective Type of research Representative authors Earnings management ... growth”, Accounting and business research, vol 29, no Buchanan, B., Tina Yang, T (2005), „ The benefits and costs of controlling shareholders: the rise and fall of Parmalat” Research in International ... substance representing the base of these transactions Baker and Hayes(2004) examine the creative accounting practices connected to: Off balance sheet financing Acknowledgement of profits Information...
  • 14
  • 693
  • 1
báo cáo hóa học:" Challenges in access to health services and its impact on Quality of Life: a randomised population-based survey within Turkish speaking immigrants in London" ppt

báo cáo hóa học:" Challenges in access to health services and its impact on Quality of Life: a randomised population-based survey within Turkish speaking immigrants in London" ppt

Ngày tải lên : 20/06/2014, 16:20
... significant number of Turkish speaking immigrants living in London Their special health issues including women’s health, mental health, and alcohol and smoking habits has been assessed The aim of ... in England and can be traced to the 1920s Increased numbers arrived in the 1940s and late 1950s A large wave from Cyprus came in the 1960s after the island became independent Another large wave ... research project was announced in seven local community-based newspapers, broadcasted in a radio and television interviews The participants in this study were reached using the database of SAfH and...
  • 28
  • 647
  • 0
b.a thesis a comparative study on making requests in vietnamese and english in terms of politeness

b.a thesis a comparative study on making requests in vietnamese and english in terms of politeness

Ngày tải lên : 05/07/2014, 08:03
... situational parameters (distance, power and legitimization) and the social meaning of the request according to cultural and situational factors In fact, requesting is defined as an act of requiring ... Request making influenced by some factors of social status, gender and age 3.1 Social status and age The effect of social status and age on request-making is investigated in situation in the questionnaire ... social status, gender and age more and less affect the way of speaking in general and requesting in particular Such factors are carefully examined and discussed to discover how differently strategies...
  • 79
  • 892
  • 4
b.a thesis a comparative study on invitations in english and vietnamese in terms of cross cultural perspective

b.a thesis a comparative study on invitations in english and vietnamese in terms of cross cultural perspective

Ngày tải lên : 05/07/2014, 08:03
... Acquiring a second language demands more than learning new words and another system of grammar (Levine and Adelman, 1982) The goal of learning a language, these days, is to be able to carry out ... misunderstandings Problems arise as language learners are not competent and fail to understand the cultural- social aspects of communication Take speech acts of invitation as an example Vietnamese saying ... teaching making invitations in particular, and raise the importance of applying cross-cultural activities to teaching and learning English to English majors in Dong Thap University in general As...
  • 91
  • 1K
  • 4
Báo cáo khoa học: "The humus of a "Parabraunerde" (Orthic Luvisol) under Fagus sylvatica L and Quercus robur L and its modification in 25 years" docx

Báo cáo khoa học: "The humus of a "Parabraunerde" (Orthic Luvisol) under Fagus sylvatica L and Quercus robur L and its modification in 25 years" docx

Ngày tải lên : 08/08/2014, 23:22
... determination of carbon in the solution was carried out using Ströhlein apparatus The determination of carbon and nitrogen in the solid state was carried out in the CHN analyser; for a more detailed ... twigs and skeletal leaf pieces The leaf pieces and the Enchytraeidae and Oribatidae faecal pellets are stored in alternate layers (0.02 g/cm ) Oh (1.5-0.0) Compact fine humus and mineral particles ... bleached sand with fine crumb structure (1.1 g/cm the remains ); of the litter are less humified, and there tunnels containing Oh and Of material; Enchytraeidae faeces are dominant, as are cavities...
  • 12
  • 210
  • 0
Báo cáo y học: "Estimation of stature from the foot and its segments in a sub-adult female population of North India" pps

Báo cáo y học: "Estimation of stature from the foot and its segments in a sub-adult female population of North India" pps

Ngày tải lên : 10/08/2014, 21:24
... was conducted in a selected area of Tehsil Kalka, in the District of Panchkula in Haryana state, Northern India The data were collected on a sample of 149 North Indian sub-adult females The participants ... Estimation of stature from the foot and its segments in a sub-adult female population of North India Kewal Krishan1,*, Tanuj Kanchan2 and Neelam Passi1 Department of Anthropology, Panjab University, ... collection and providing all the facilities for conducting this research Many thanks to the Principals 14 of Government Schools located in villages Nanakpur, Marranwala and Bassolan of Tehsil Kalka,...
  • 33
  • 480
  • 0
Báo cáo y học: " Profile of subjective quality of life and its correlates in a nation-wide sample of high school students in an Arab setting using the WHOQOL-Bref" pot

Báo cáo y học: " Profile of subjective quality of life and its correlates in a nation-wide sample of high school students in an Arab setting using the WHOQOL-Bref" pot

Ngày tải lên : 11/08/2014, 15:22
... sample using an internationally validated instrument, based on a conceptual framework, and we analyzed our data in such a way as to make QOL data clinically relevant as a population health measure ... roles in data collection: Zaina Al-Zabin, Nahed Kamel, Abdel W Awadalla, and Sumai (and Ministry of Education Headquarters counseling unit staff) Joy Wilson for data entry We are most grateful ... this article as: Al-Fayez and Ohaeri: Profile of subjective quality of life and its correlates in a nation-wide sample of high school students in an Arab setting using the WHOQOL-Bref BMC Psychiatry...
  • 12
  • 500
  • 0
Prevalence of severe mental distress and its correlates in a population-based study in rural south-west Uganda doc

Prevalence of severe mental distress and its correlates in a population-based study in rural south-west Uganda doc

Ngày tải lên : 11/08/2014, 15:22
... smoking for males and females Missing data on age at first sex for male and females Missing data on partners in past year for males and females Missing data on consulting a traditional healer ... (67.5%) Missing marital status for male and female Missing data on education for males and females Missing SES index for 45 males and 69 females Missing data on current smoking for males, and on ever ... females and 63.2% of the males were sexually active A small minortiy (4.2% of males and 6.0% of females) had ever consulted a traditional healer On clinical factors, 0.6% of males and 0.3% of females...
  • 9
  • 248
  • 0
Báo cáo y học: " A multiscale mathematical model of cancer, and its use in analyzing irradiation therapies" ppt

Báo cáo y học: " A multiscale mathematical model of cancer, and its use in analyzing irradiation therapies" ppt

Ngày tải lên : 13/08/2014, 23:20
... model and integrated up to the macroscopic scale Methods Oncogenesis is a set of sequential steps in which an interplay of genetic, biochemical and cellular mechanisms (including gene pathways, intracellular ... signals as inputs p53 is activated when DNA is damaged and leads the cell to apoptosis SMAD is activated through TGFβ receptors during hypoxia and inhibits cell proliferation Overpopulation inhibits ... cycle and are directed to apoptosis They die and disappear from the computational domain after TApoptosis, i.e the duration of the apoptotic phase The standard radiotherapy protocol used in the...
  • 19
  • 315
  • 0
a contrastive analysis of english and vietnamese resignation letters in terms of discourse structure = phân tích đối chiếu cấu trúc diễn ngôn của đơn thư từ chức trong tiếng anh và tiếng việt

a contrastive analysis of english and vietnamese resignation letters in terms of discourse structure = phân tích đối chiếu cấu trúc diễn ngôn của đơn thư từ chức trong tiếng anh và tiếng việt

Ngày tải lên : 02/03/2015, 14:17
... of language above or beyond the sentence, language as meaning in interaction, language in use, and language in situational and cultural context 2.1.2 Discourse and Text: There have been so many ... for applied ends; it is an analysis of text to derive an indication in a rationale of why genre texts have acquired certain features Bhatia (1991) considers genre analysis as the analytical framework ... necessarily coincide with paragraphs - more than one move/step appears in the same paragraph and one move/step can appear in two different paragraphs 19 Table 5: The list of moves and steps in English...
  • 71
  • 1K
  • 3
A contrastive analysis of English and Vietnamese resignation letters in terms of discourse structure

A contrastive analysis of English and Vietnamese resignation letters in terms of discourse structure

Ngày tải lên : 10/08/2015, 19:46
... participants and methods which are applied to collect and analyze the data Chapter – Analysis of Discourse Structure in English and Vietnamese Resignation Letters In this chapter, the author analyzes ... discourse analysis of English and Vietnamese resignation letters I only concentrate on analyzing English and Vietnamese resignation letters in terms of discourse structures Research Question: What are ... Press Crystal, D (1992), Introducing Linguistics, London: Penguin Ding, H (2007), “Genre analysis of personal statements: Analysis of moves in application essays to medical and dental schools”,...
  • 6
  • 812
  • 7