marking the landing site at night
Báo cáo y học: "Preliminary evidence for a change in spectral sensitivity of the circadian system at night" potx
... and participated in the data analyses and interpretation MSR conceived the study, helped to collect the data, participated in the data analyses and interpretation, and helped to draft the manuscript ... beyond the scope of this short communication, the model does predict greater overall melatonin suppression from the blue LED source at 18 lx (29 µW/cm2) at the cornea than from the Hg source at 450 ... adjusted so that only the red phosphor was used and provided no more than lx at subjects' eyes when they sat at the boxes Another small hole in the back of each box accommodated the zoom lens...
- 9
- 363
- 0
Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx
... estimated to have a dissociation constant in the millimolar range or higher despite the fact that the Km is c 20 lM [37,38] Another difference in the assays is the concentration of the substrate, ... affecting the ability of E1 to catalyse the reductive acetylation of the tethered lipoyl domain in the assembled PDH complex It should be noted that Tyr281 and Arg282 are located at the mouth of the ... any of the mutations in E1a (Fig 4) Therefore, any effects of the mutations on the catalytic activities of the PDH complex must be due to direct effects on the reactions catalysed by E1 The falls...
- 10
- 459
- 0
Báo cáo khoa học: Binding of ATP at the active site of human pancreatic glucokinase – nucleotide-induced conformational changes with possible implications for its kinetic cooperativity doc
... mm The fact that the kinetic cooperativity is dependent on the MgATP concentration is consistent with previous data reported for the rat liver isoform [33,34] With MgATP as the variable substrate, ... molecular motion was further indicated by the dyndom algorithm [30], with the coordinates obtained for the ligand-free form and the hGK–ATP complex at the end of the simulations (Figs 6B,C and ... simulations of the modelled binary GK–ATP complex revealed that the global rmsd of the structure converged at the end of the 2-ns simulation period (Fig S2A) The dynamic changes in the active site cleft...
- 15
- 374
- 0
Báo cáo khoa học: Site-directed mutagenesis of selected residues at the active site of aryl-alcohol oxidase, an H2O2-producing ligninolytic enzyme pot
... are situated at similar distances from the hydroxyl of the docked substrate, they could cooperate in facilitating the hydride transfer from substrate to FAD The decrease of activity of the AAO ... kcat kcat ⁄ Km Y78A Km kcat kcat ⁄ Km Y92F Km kcat kcat ⁄ Km L315A Km kcat kcat ⁄ Km F501A Km kcat kcat ⁄ Km F501Y Km kcat kcat ⁄ Km m-Anisyl alcohol p-Anisyl alcohol Veratryl alcohol 2,4-Hexadien-1-ol ... H546R GGTCGGTCAATTGCGGCTCCTCGCGGCCGTATG GGTCTAGCTCTGTTCACGCCATGGTCATGATGCG GGTCTAGCTCTGTTCACTTCATGGTCATGATGCG CCGACCATTTGGCCCTTCCTGCTGCC CGCCAACACGATTGCCCACCCAGTTGGAACGG GCCAACACGATTTTACGACCAGTTGGAACGGC...
- 11
- 471
- 0
Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt
... network of interactions that hold the terminal glucose of the bglucan substrate in the )1 subsite at the bottom of the active site pocket [20] The entrance to the active site pocket of Exg is flanked ... with the protein Two of these water molecules coincide with the C2-OH and C3-OH groups in native Exg, whereas the third occupies the space created by the E292S mutation This situation provides the ... towards aromatic triads that can accommodate the twists specifically associated with b-1,3-glucan polymers The nature of the aromatic residues in the two triads might then be reflecting the different...
- 13
- 498
- 0
Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx
... with the substituent on the amino moiety of the substrate, confirming that the formation of acyl enzyme (AE) is the rate-limiting step of the reaction The Hammett plot of log(kcat,R ⁄ kcat,H) ... phenylmethanesulfonyl-SerB1 derivative These structures are mimics of the stationary points along the reaction pathway; they depict the changes in the spatial structure of the active site during catalysis Phenylacetic ... active site was constructed It illustrates the reorganization of the hydrogen bond network at the active site, which predetermines the catalytic transformations Several functional groups in the...
- 10
- 425
- 0
Báo cáo khoa học: Studies on the regulatory properties of the pterin cofactor and dopamine bound at the active site of human phenylalanine hydroxylase pptx
... which is the fractional decrease of phosphorylation rate seen at the concentration x of H4biopterin vo is the rate in the absence of H4biopterin and vmin is the rate at very high concentrations ... suggested the presence of several putative binding sites for the natural cofactor H4biopterin The proposed binding sites are a regulatory site (outside the active site) that is responsible for the ... bidentate coordination to the active site iron [17] Whereas the inhibition of the catalytic activity by catecholamines is well understood at the structural level [17], the molecular mechanism of the...
- 10
- 470
- 0
Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf
... generated using CLUSTALW The most likely candidate for the catalytic glutamate of propionate CoAtransferase based on these data was glutamate 324 (Fig 3) Detection of glutamate 324 as the catalytic ... allowed the identi®cation of the active site carboxylate The predicted derivatives were located exclusively on glutamate 324, which led us to conclude that this residue is the active site carboxylate ... preparation These data indicated that a small but signi®cant fraction of the puri®ed CoA-transferase was trapped as the enzyme-CoA thiol ester intermediate It has been Site- speci®c label of the catalytic...
- 9
- 498
- 0
Báo cáo Y học: Biosynthesis of vitamin B2 An essential zinc ion at the catalytic site of GTP cyclohydrolase II ppt
... ACACAGAATTCATTAAAGAGGAGAAATTAACCATG GCAAATGGGATCCACAATGCAAGAGG CATTCCGAATCTCTGACTGGTGAC GTCACCAGTCAGAGATTCGGAATG GCTTGCTGTCTGATTGTGGCTTC GAAGCCACAATCAGAACGCAAGC GCGCTGCGATTCCGGCTTCCAGC GCTGGAAGCCGGAATCGCAGCGC ... velocity Specifically, the rate for the C54S mutant was 60% of that of the wild-type, and the relative rates of the C65S and C67S mutants were in the range 10–20% It follows that the zinc ion is not ... tetrahydrofolate pathway start from GTP (Fig 1) The first step of each pathway involves the hydrolytic opening of the imidazole ring of the substrate with formation of formate as a byproduct However, the...
- 7
- 367
- 0
Báo cáo Y học: Identification of a critical lysine residue at the active site in glyceraldehyde-3-phosphate dehydrogenase of Ehrlich ascites carcinoma cell ppt
... present in the active site of rabbit muscle Gra3P DH All these studies convincingly demonstrate that the loss of the enzymatic activity on treatment with TNBS was due to the modification of a ... interaction with the substrate binding site of the enzyme, even at higher concentrations failed to protect the enzyme activity against TNBS or PP inactivation The small amount of the substrates GraP ... properties Therefore, in this paper we investigated the amino-acid residue(s) that are critically involved at the active site of the EAC cell enzyme and whether there is any difference between the malignant...
- 8
- 283
- 0
Báo cáo khoa học: Kinetics of the quinone binding reaction at the QB site of reaction centers from the purple bacteria Rhodobacter sphaeroides reconstituted in liposomes docx
... are the decay velocity and the decay the charge separated state that is generated in the RC velocity distribution, respectively) The ratio C/B repfollowing the absorption of a photon in the absence ... that the ligand in the binding 53 result larger than the same rate for the oxidized form: (kout)QH2 ‡ (kout)Q Conversely, from the hypothesis that channel, either taken up or released, moves at ... that the charge separated and neutral RCs ratio as small as three, the QB site was fully occupied When exchange quinones with the same kinetics, regardless of the the electron reaches the QA site...
- 11
- 365
- 0
cobble circles and standing stones archaeology at the rivas site costa rica mar 2004
... placed a x meter pit that traversed the wall of the structure at its northeast side In neither location were post molds found It may be that the nature of the soils at the site does not preserve ... distance The Rivas site is on the other side of the ridge, while the town of Rivas is on the far left from the foothills On one side of the ridge lies the modern town of Rivas and on the other, the ... rare The fact that the cobble was placed with the petroglyph side up, however, suggests that the design was appreciated Since other petroglyphs are found at the site, it is likely that the design...
- 233
- 321
- 0
The Sky at Night Phần 1 pdf
... correlate the first Lunik pictures of the far side He was also at NASA for the lunar mapping prior to the Apollo missions Chris Lintott, the co-star of the latest episodes of The Sky at Night, ... their astronomical hero Over the past five decades, the Sky at Night has managed to talk to the space scientists and astronomers making the landmark discoveries No matter how busy they are, they ... programmes, with Sir Patrick at the helm presenting the show, reminding us why we should step outside and look up at the night sky There is a whole universe out there, and Sir Patrick Moore is going...
- 19
- 213
- 0
The Sky at Night Phần 2 pps
... is true for the various orbiters, of which the latest are Odyssey, Mars Express and MRO The NASA designers have reasons to congratulate themselves Further, the Cassini probe at Saturn has also ... by observatories all over the world as well as from space telescopes such as the HST For the Sky at Night, Chris Lintott was at Palomar, where the 200-in Hale reflector was aimed at the comet ... hydrocarbons, plus silicates The collision shed new light on cratering, particularly with the pristine material of the interior Comets are incredibly ancient; they date back to the origin of the Solar System...
- 19
- 276
- 0
The Sky at Night Phần 3 doc
... so that it could contain the whole of the Earth’s orbit However, the data for Eta Carinae, the erratic variable in the southern hemisphere of the sky, are more reliable The luminosity is at least ... an effort of the imagination to appreciate that some of the stars are huge enough to contain the whole orbit of the Earth round the Sun – while admittedly others are so tiny that they could fit ... have remained obstinately silent During the programme, Chris also went to another of the great observatories, the Keck, where there are two of the largest telescopes in the world There he talked...
- 19
- 221
- 0
The Sky at Night Phần 4 ppt
... any other planet apart from Jupiter; the quick spin means that the equator bulges out, and any small telescope will be good enough to show that the disk is markedly flattened The upper atmosphere, ... is comparatively deficient in hydrogen, which is the most plentiful element in the universe as a whole (atoms of hydrogen far outnumber the atoms of all the other elements put together) There was ... whose path it takes from rather beyond the Kuiper Belt out to the region of the much more distant Oort Cloud, far beyond the reach of even the Hubble Space Telescope Some satellites of the giant...
- 19
- 216
- 0
The Sky at Night Phần 5 ppsx
... helioseismology is the revelation that the Sun spins in a rather unexpected way Of course, it has long been known that we are dealing with differential rotation; at the equator, the rotation period ... relegated the programme to two o’clock in the morning On the previous month he had forgotten to schedule the Sky at Night at all, with the result that the programme was transmitted a week late ... the Sun, and the inner regions of the Sun rotate in the way that a solid sphere would 18 The Sounds of the Stars 71 The Sun is a normal star, and other stars may be expected to show the same acoustic...
- 19
- 212
- 0
The Sky at Night Phần 6 pptx
... years The axial inclination is slightly greater than that of the Earth, and the rings and the orbits of all the main satellites apart from Iapetus lie practically in the plane of the equator There ... the Sun so that the seasons are a great deal longer This also applies to Titan because like all the other major satellites (except Iapetus) its orbit lies almost in the plane of Saturn’s equator, ... would estimate that the odds in favour are around 99.9%, and it is very difficult to suggest any other explanation At Titan’s surface temperature of −180°C, the lakes cannot contain water and must...
- 19
- 204
- 0
The Sky at Night Phần 7 pptx
... conditions, with the radiant at the zenith or overhead point In practice, these conditions are never attained, so that the observed rate is always less than the theoretical ZHR) There are three ... comparatively small target in the vastness of space The situation may be likened to that of two orderly crowds passing through each other But the material between the stars will be colliding all the ... than the Sun – so that they can certainly make their presence felt We have every reason to believe that there is a black hole in the centre of our Galaxy, because we can measure the speeds at which...
- 19
- 260
- 0
The Sky at Night Phần 8 pps
... that the universe is expanding, with each group of galaxies racing away from all other groups; the further apart they are, the faster they are separating Gravitational influence should make the ... or whether they are totally alien These are how things rest at the present We are confident that dark matter does exist, but we have not the faintest idea what it is like “And what about the acceleration ... could well locate them If so, I hereby promise that The Sky at Night will give a suitable prize to the discoverer of the first Vulcanoid! Time will tell Chapter 32 The Flight of the Phoenix...
- 19
- 228
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25