manipulate the access control lists of a file or directory
The Design and Implementation of a Log-Structured File System
Ngày tải lên :
12/09/2012, 15:05
... log as the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repository for data: a separate data area is ... in worse performance than a system with no locality! We tried varying the degree of locality (e.g 95% of accesses to 5% of data) and found that performance got worse and worse as the locality ... increasing the amount of data lost during a crash For this paper we will assume that crashes are infrequent and that it is acceptable to lose a few seconds or minutes of work in each crash; for applications...
- 15
- 1.4K
- 0
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis
Ngày tải lên :
05/09/2013, 16:11
... is refined latent heat of vaporization of water at the condenser surface of last stage (J/kg), h fgNs is latent heat of vaporization of water at the condenser surface of the last stage (J/kg), ... condensation The outlet temperature from the flat plate collectors, latent heat and refined latent heat of vaporization of water from each stage and specific heat capacity of water from each stage are averaged ... taken as outlet temperature of the parallel combination Each flat plate collector has an area of 1.35m2 inclined at an angle equal to latitude of Chennai (13o) facing towards due south for the...
- 26
- 568
- 0
the meaning and structure of a narrative a systemic functional analysis
Ngày tải lên :
07/09/2013, 13:48
... for the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... grammar are different from formal models of grammar by their focus on the communicative aspect of language 2.4 Metafunctions Halliday developed a theory of the fundamental functions of language ... of the clause; and the Rheme is the remainder of the message The Theme may be a nominal group, an adverbial group, or a prepositional phrase The Theme may be single or multiple, marked or unmarked...
- 39
- 826
- 2
Access Control Lists
Ngày tải lên :
16/10/2013, 20:15
... Inc Case Study: Access Control Lists (ACLs) 1-15 Phase 6: Test network The Company requires a demonstration of the functionality of the Main Building network and asks that a logically equivalent ... and port names such as IDFFloor 1, Floor1Room1Port1 HCC1:Floor1Room1Port1; VCC1:Floor1XFloor2Port1 are acceptable If any standards apply in the region then these should be used On each floor the ... help with the physical layer design the company has provided a diagram from their old site The company requires a similar diagram for the Main Building The Main Building has three floors and will...
- 20
- 469
- 0
Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc
Ngày tải lên :
12/02/2014, 20:20
... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... Sayer verbal said 27 Senser mental understand 28 Actor material working 29 Actor materialswitched on 30 Actor material work 31 Sayer verbal said 32 Goal material are stuck 33 Actor material take ... relational was III Senser mental see Existent relational were Actor material descended Actor material landed Actor material put on Goal Actor material opened Goal Actor material climbed 10 Actor material...
- 18
- 712
- 4
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
Ngày tải lên :
14/02/2014, 14:20
... CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC RPE65c-His-Fwd ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC ... iron-dependent Characterization of the kinetic parameters of the enzymatic activity of zebrafish RPE65c To determine the steady-state kinetics of the enzymatic activity of zebrafish RPE65c, the assay conditions...
- 14
- 753
- 0
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc
Ngày tải lên :
14/02/2014, 15:20
... neutral and alkaline pH; PhyH-DII was less stable under the same conditions (Fig 2D) PhyH was basically stable at 35 °C, and retained 60% of the initial activity at 45 °C for 90 when assayed at ... phosphate was released over that of PhyH-DII alone More phosphate (1.17– 2.49 fold) was also released after subsequent addition of PhyH-DI to a BPP (168PhyA or PhyP), or an HAP (E coli AppA) and ... of PhyH-DI and PhyH-DII and two times greater than that of PhyHDII This large variance cannot be ascribed to the function of PhyH-DI alone The dual-domain phytase was shown to be a dimer according...
- 9
- 801
- 0
Tài liệu Linking the Gaza Strip with the West Bank: Implications of a Palestinian Corridor Across Israel docx
Ngày tải lên :
16/02/2014, 11:20
... the war was the impact of a major hurricane that affected East Pakistan The apathy of the West Pakistani leadership and their failure to aid East Pakistan only aggravated an already tense situation ... Palestinians between Gaza and the journalists in the West Bank and Gaza having received West Bank death threats because of their coverage of the state of lawlessness and anarchy in PA-controlled areas.11 ... constitute a breach of the agreement or at the least a tacit renunciation thereof On this basis, Israel could legitimately terminate the use of safe passage to access the safe passage so as to detect and...
- 64
- 307
- 0
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx
Ngày tải lên :
19/02/2014, 17:20
... optimization The half-height widths of the NMR signals were used as a measure of the uncertainty of each NMR data point and an experimental uncertainty of 2% was assumed for the experimental points of the ... values for the redox–Bohr interactions and the macroscopic pKa values are absolute, and therefore the macroscopic pKa values of the various redox stages show only very small modifications relative ... thermodynamic model to the NMR data (for the case of DvHc3:ZnRb), or to the NMR and UV-visible data sets simultaneously (for the case of DvHc3:Pi) using the Marquardt method for parameter optimization...
- 10
- 640
- 0
Tài liệu The Design and Performance of a Real-time CORBA Event Service doc
Ngày tải lên :
19/02/2014, 18:20
... Sensor Proxies If data was not availHigh Level able to be pulled, the calling I/O Facade would need to block I/O Facade I/O Facade I/O Facade Abstraction awaiting a result In order for the I/O Facade ... hardware, such as Forward Looking Infrared Radar, requires a new Sensor Proxy, I/O Facades must be altered to take advantage of the new technology ample has the following participants: Aircraft ... correlation of events For instance, an I/O Facade may depend on data from a subset of all Sensor Proxies Furthermore, it may use data from many Sensor Proxies in a single calculation of aircraft position...
- 20
- 737
- 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf
Ngày tải lên :
21/02/2014, 03:20
... state B, active state above pH 6.3 side-chain at residue 210 is dispensable, as shown by the fact that H21 0A and H210S are as active as native API with VLK-MCA as a substrate (Table 1) This means ... by the Trp169–His210 stacking, suggesting that API has a catalytic quadruple apparatus, composed of Ser194, His57, Asp113 and His210, rather than a catalytic triad ACKNOWLEDGEMENT We are grateful ... to Dr T Yamazaki for NMR measurements, Y Yagi for the amino acid analysis, and Y Yoshimura for the sequence analysis REFERENCES Masaki, T., Nakamura, K., Isono, M & Soejima, M (1978) A new proteolytic...
- 7
- 603
- 0
Đề tài " Numerical characterization of the K¨ahler cone of a compact K¨ahler manifold " doc
Ngày tải lên :
05/03/2014, 23:20
... there exists a very neat characterization of nef classes on arbitrary surfaces, K¨hler or not a The Main Theorem has an important application to the deformation theory of compact K¨hler manifolds, ... Annals of Mathematics, 159 (2004), 1247–1274 Numerical characterization of the K¨hler cone of a compact K¨hler manifold a a By Jean-Pierre Demailly and Mihai Paun Abstract The goal of this work ... MIHAI PAUN The proof is based on a mass concentration technique for Monge-Amp`re e equations, using the Aubin-Calabi-Yau theorem We first start with an easy lemma, which was (more or less) already...
- 29
- 468
- 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt
Ngày tải lên :
06/03/2014, 09:22
... To test the ability of HP8Xa to cleave proSpatzle, 25 ng of ¨ factor Xa-activated HP8Xa or 50 ng of factor Xa alone as a control was incubated with 100 ng of proSpatzle in the ¨ presence of 20 ... used as template for quantitative RT-PCR analysis The M sexta ribosomal protein S3 (rpS3) mRNA was used as an internal standard to normalize the amount of RNA template The primer pairs used are ... whether activated HP8Xa could hydrolyze the HP8 substrate Ile-Glu-Ala-Arg-p-nitroanilide (IEARpNA) [31] ProHP8Xa lacked IEARase activity, but after the zymogen was activated by factor Xa, IEARase...
- 15
- 540
- 0
Understanding the Insider Threat - Proceedings of a March 2004 Workshop potx
Ngày tải lên :
06/03/2014, 16:20
... dataset of normal, and “insider threat” network activities; data from the ARDA NIMD4 study; data obtained from use of the Glass Box5 software; synthetically generated data from a simulator; and ... Another insider installs a keystroke logger to get a few passwords to another computer in the same office • A database administrator makes an extra copy of the database files, but says the tapes ... (including that of a system administrator), and artificial or real sensor data that include a mix of legitimate and malicious activity Potential sources for the development of such datasets include a MITRE...
- 137
- 344
- 0
Báo cáo khoa học: Val216 decides the substrate specificity of a-glucosidase in Saccharomyces cerevisiae doc
Ngày tải lên :
07/03/2014, 16:20
... from ORF YGR287c The sequence data for isomaltase is available from the DNA Data Bank of Japan with accession number AB109221 The entire coding region of the insert was amplified by PCR and subcloned ... II of maltase is the catalytic nucleophile Because the Asp214 of maltase is equivalent to the Asp215 of isomaltase, a mutant with the residue altered to Ala was tested for its activity on a- pNPG ... characterized based on substrate specificities for maltase, isomaltase, a- mg, sucrose, and a- pNPG, and the Km for a- pNPG MAa/IMb and IMa/MAb were constructed by a recombination of the N-terminal...
- 7
- 452
- 0
Báo cáo khoa học: Unravelling the functional interaction structure of a cellular network from temporal slope information of experimental data docx
Ngày tải lên :
07/03/2014, 21:20
... response) pathway for hyperosmolarity adaptation in budding yeast (Saccharomyces cerevisiae) and based on the related mRNA expression time-series data from Stanford Microarray Databases Results ... temporal slope information A K.-H Cho et al B Fig An artificial model network with four nodes for the in-numero example (A) and a simple real example for the partial interaction structure of the ... can be applied to any larger cases in the B Fig Temporal expression profiles (A) and a summary of the analysis results (B) for the artificial example system The small circle points on each temporal...
- 10
- 375
- 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
Ngày tải lên :
08/03/2014, 08:20
... conformations of the b-amino acids backbone, corresponding to gauche rotamers around the Ca–Cb bond, can overlap canonical backbone conformers observed for a- amino acids Therefore the addition of ... cannot overlap any conformation of a- amino acids In order to visualize on the potential energy surfaces the conformers of b-amino acids that fit with canonical conformations of a- amino acids, two ... potent as NKA and [Ala8]NKA on rabbit pulmonary artery and rat portal vein, two NK-2 receptor bioassays [43] More recently, the same Ala substitution was reported to cause a significant decrease...
- 11
- 860
- 0
The Project Gutenberg EBook of A First Book in Algebra, pot
Ngày tải lên :
15/03/2014, 00:20
... ride? A man bought books and lamps for $14 The price of a lamp was twice that of a book What was the cost of each? George bought an equal number of apples, oranges, and bananas for $1.08; each apple ... − 7a − 3a From take 2a 5a − 3a To add 2a − 5a − 3a From take − 4a To − 4a − 3a add 3a a a The principle is clear; namely, The subtraction of any number gives the same result as the addition of that number ... remain in the tank at the end of five days? 18 Two men are 150 miles apart, and approach each other, one at the rate of x miles an hour, the other at the rate of y miles an hour How far apart...
- 189
- 432
- 0
The Design and Implementation of a Sequence Database System * docx
Ngày tải lên :
16/03/2014, 16:20
... managementfor large volumes of data It also provides a threads packagethat interacts with the rest of the storagemanagement layers; PREDATORusesthis packageto build a multi-threaded server The core of the ... PIVceeding of the ACM SIGMOD Conference on Management of Data, May 1994 [CS92] RakeshChandmand Arie Segev.ManagingTemporalFinancial Data in anExtensible Database.In Proceedings of the International Conference ... Unix file system and the SHORE storage manager The default repository is built using the SHORE storagemanagerlibrary Data volumesmaintained by SHOREcanresideeither directly on raw disk, or on the...
- 12
- 568
- 0
Báo cáo khoa học: Investigation of the substrate specificity of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics analysis pdf
Ngày tải lên :
16/03/2014, 18:20
... ÔeÕ stands for an equatorial hydroxyl and a for an axial one Therefore, the interaction between any residue at position 39 and an equatorial 4-OH was called /4e, and between any residue at position ... sequence was 5¢-GGAGTCTAATGGACAACTTTNNNTGGATGGA GGGTTATATTGAGCG-3¢, with GAC, CAA and TCA as mutated codons for E451D, E451Q and E451S, respectively DNA sequencing was used to confirm the incorporation ... affected by the exchange of a charged participant (carboxyl group of the E side-chain) for an uncharged participant (amide group of the Q side-chain) Otherwise, the replacement of E451 with D and S...
- 9
- 371
- 0