makin g the ca se for pe rformace mea surement and pe rformance based mana gement

Tài liệu Produced jointly by the British HIV Association (BHIVA), the British Association for Sexual Health & HIV (BASHH) and the Faculty of Family Planning & Reproductive Health Care doc

Tài liệu Produced jointly by the British HIV Association (BHIVA), the British Association for Sexual Health & HIV (BASHH) and the Faculty of Family Planning & Reproductive Health Care doc

Ngày tải lên : 13/02/2014, 10:20
... UK guidelines for the management of syphilis, genital herpes and warts in people with HIV These should be referred to if managing individuals with these conditions – I Management of hepatitis and ... guidelines for the management of syphilis, genital herpes and warts in people with HIV These should be referred to if managing individuals with these conditions – I Management of hepatitis and blood ... immunosuppressed for many years There may therefore be a need for more intense surveillance on a case-by-case basis The use of newer screening techniques for cervical screening Liquid based cytology (LBC)...
  • 62
  • 553
  • 0
The Economic Impacts for Ireland of High Oil and Gas Prices doc

The Economic Impacts for Ireland of High Oil and Gas Prices doc

Ngày tải lên : 08/03/2014, 06:20
... challenging and arguably futile Forecasts can respond quite dramatically to current THE ECONOMIC IMPACTS FOR IRELAND OF HIGH OIL AND GAS PRICES 05 Oil and Gas Prices and their Determinants 06 Figure ... from for Energy Regulation historical and expected THE ECONOMIC IMPACTS FOR IRELAND OF HIGH OIL AND GAS PRICES 15 Ireland‘s dependence on Oil and Gas future dominance of oil and gas in Ireland’s ... Public lighting Pillar 4: Maximising electricity usage in end-use applications • Expanding the use of e-cars and hybrid cars • Improving the energy efficiency of diesel public buses through hybrid...
  • 32
  • 495
  • 0
Investing in Nursing Education to Advance Global Health: A position of the Global Alliance for Leadership in Nursing Education and Science pptx

Investing in Nursing Education to Advance Global Health: A position of the Global Alliance for Leadership in Nursing Education and Science pptx

Ngày tải lên : 14/03/2014, 21:20
... demand for more nursing graduates, including government investment in additional seats, the opening of new nursing schools, and the introduction of new program models The demand for nurses and the ... demand for healthcare services is expected to increase with the aging of the population and the documented increase in chronic disease, such as obesity and diabetes The decade between 1999 and 2009 ... education Given the aging of the baby boomers and the expected retirement of a large segment of the nurse population, steps must be taken now to ensure that world supply of nurses is strengthened before...
  • 6
  • 562
  • 0
Báo cáo khoa học: The structural basis for catalytic function of GMD and RMD, two closely related enzymes from the GDP-D-rhamnose biosynthesis pathway pdf

Báo cáo khoa học: The structural basis for catalytic function of GMD and RMD, two closely related enzymes from the GDP-D-rhamnose biosynthesis pathway pdf

Ngày tải lên : 16/03/2014, 01:20
... 5¢-AGGCCCGCTTC CGGATCCACTCAGCGTCTG-3¢ and 5¢-AAAAAAGTCG ACTTCTTCTCGTACCCGTGACTC-3¢; and A thermoaerophilus, 5¢-TTGGATCCATGAGAGCCCTAATCACTG GA-3¢ and 5¢-TAGGTACCTTATGCTTGACGGTAACT TTGT-3¢ Restriction ... A-band O polysaccharide [21,22], and contains genes for the expression of GMD and RMD homologs, gmd (originally called gca) and rmd, respectively Genetic evidence supports the annotation of these ... propose that Arg185 in P aeruginosa GMD is important for aligning NADP and GDP-d-Man in the active site for the dehydratase reaction This role is suggested by the close relative positions of the...
  • 15
  • 402
  • 0
The Career Ideas for Kids who like Music and Dance docx

The Career Ideas for Kids who like Music and Dance docx

Ngày tải lên : 16/03/2014, 07:20
... Music and Dance The Career Ideas for Kids series Career Career Career Career Career Career Career Career Career Career Ideas Ideas Ideas Ideas Ideas Ideas Ideas Ideas Ideas Ideas for for for for for ... a performer’s career and help guide their clients toward the best opportunities The right personal manager can often mean the difference between mediocre and mega success for all kinds of performers ... to get their client’s schedule filled with interesting (and lucrative) performance dates Either way, booking agents spend a good portion of any day on the phone making arrangements and staying...
  • 207
  • 294
  • 1
Timeshare Management: The key issues for hospitality managers (Hospitality, Leisure and Tourism)

Timeshare Management: The key issues for hospitality managers (Hospitality, Leisure and Tourism)

Ngày tải lên : 16/03/2014, 11:21
... because they have a need for a sense of permanence and belonging to a specific location They are most likely to visit the resort and their unit regularly at the time of the week purchased Critical ... that opened up property purchase to a larger number of people meant that there were more buyers They had to increase and change marketing and sales activities, because they were now selling the ... Young, 2006:15 Timeshare Evolving In the 1970s, US property developers were going through a crisis and were looking for innovative ways to sell properties The fact that they were selling properties...
  • 225
  • 501
  • 1
Đề tài " The subconvexity problem for Rankin-Selberg L-functions and equidistribution of Heegner points " ppt

Đề tài " The subconvexity problem for Rankin-Selberg L-functions and equidistribution of Heegner points " ppt

Ngày tải lên : 22/03/2014, 16:20
... experience, ideas and even the manuscripts (from the roughest to the most polished versions) of their respective ongoing projects; I thank them heartily for this, for their encouragement and their ... specially the case of Rankin-Selberg L-functions, when f is a holomorphic cusp form of weight two and g = g is the holomorphic weight one cusp form (resp the weight zero Maass form with eigenvalue ... s, the parameters at infinity of f and g (i.e the weight or the eigenvalue of the Laplacian) and on the level of g Remark 1.2 One can check from the proof given below, that the dependence in the...
  • 53
  • 455
  • 0
báo cáo hóa học: " The Psychosocial Screen for Cancer (PSSCAN): Further validation and normative data" pptx

báo cáo hóa học: " The Psychosocial Screen for Cancer (PSSCAN): Further validation and normative data" pptx

Ngày tải lên : 18/06/2014, 19:20
... was not further investigated here because level of social support is not typically used for making clinical diagnoses, and because no meaningful cut-offs were available for comparison The HADS ... curve analyses were performed for the anxiety and the depression subscales of PSSCAN and the corresponding validated measure namely the HADS anxiety and depression subscales The resulting ROC curve ... displays the varying sensitivity and specificity percentages depending on which PSSCAN score is used as the cut-point As the data in Figure 1a indicate, a cut-point of or above is therefore best for...
  • 8
  • 513
  • 0
Báo cáo hóa học: " Research Article Strong Convergence Theorems of the CQ Method for Nonexpansive Semigroups Huimin He and Rudong Chen" pptx

Báo cáo hóa học: " Research Article Strong Convergence Theorems of the CQ Method for Nonexpansive Semigroups Huimin He and Rudong Chen" pptx

Ngày tải lên : 22/06/2014, 19:20
... Point Theory and Applications Therefore the sequence { xn − x0 } is bounded and nondecreasing So lim xn − x0 exists (2.12) n→∞ On the other hand, from xn+1 ∈ Qn , we get xn − xn+1 ,x0 − xn ≥ 0, and ... x0 for each n ∈ N ∪ {0}, where αn ∈ [0,a] for some a ∈ [0,1) and tn ≥ limn→∞ tn = then the sequence {xn } converges strongly to PF x0 In the sequel, we will need the following definitions and ... Fixed Point Theory and Applications, vol 2007, Article ID 32870, pages, 2007 [9] K Nakajo and W Takahashi, “Strong convergence theorems for nonexpansive mappings and nonexpansive semigroups,” Journal...
  • 8
  • 296
  • 0
báo cáo khoa học:" Use of the intraosseous screw for unilateral upper molar distalization and found well balanced occlusion" pdf

báo cáo khoa học:" Use of the intraosseous screw for unilateral upper molar distalization and found well balanced occlusion" pdf

Ngày tải lên : 11/08/2014, 23:22
... Using the Bimetric Distalizing Arch Semin Orthod 2000, 6:106-118 Authors' contributions IEG, AIK and TB performed the described operation and participated in the paper design IEG drafted the ... (Figures 5, 6, 7) The insertion procedure of the screws was quick and simple The patient reported no pain required analgesic after the insertion and during the distalization period Depending on ... on the grooves to establish mechanical locking between the screw and the surrounding bone The insertion procedure took 5–8 minutes and no needed opening mucoperiostal flap They weren't seen inflammation,...
  • 6
  • 411
  • 0
windows administration at the command line for windows 2003, windows xp, and windows 2000 (2006)

windows administration at the command line for windows 2003, windows xp, and windows 2000 (2006)

Ngày tải lên : 26/10/2014, 21:49
... managing the system and obtaining the status information You can also use the command line to set up performance monitors, alerts, and logs Of course, you can use the Performance console in the ... Managing the ATM Call Manager with the ATMAdm Utility Getting the Media Access Control Information with the GetMAC Utility Getting the NetWare Routing Information ... running on your machine? You can’t tell from the GUI The best view you can get is Processes tab of the Task Manager that you can access by right-clicking the Taskbar and choosing Task Manager from...
  • 554
  • 290
  • 0
Scientific basis of the forecasting demand for human resource with colleges and higher education qualification in vietnam

Scientific basis of the forecasting demand for human resource with colleges and higher education qualification in vietnam

Ngày tải lên : 19/08/2015, 13:27
... influencing the forecast and identifying key parameters, data acquisition and proposing different hypothesis for the forecasting, performing the forecasting, validating the forecasting result and implementing ... influencing forecasting equations as well as the conditions for peforming the forecast  There are lots of capabilities and limitation of the staff peforming the forecasting task on the demand for ... goal: Based on the argumenting and practical research to propose procedures, techniques and solutions for improving the conditions as for performing the forecasting for the demand Trang for human...
  • 33
  • 370
  • 0
A WORLD WIDE REVIEW OF THE COMMERCIAL PRODUCTION OF BIODIESEL – A technological, economic and ecological investigation based on case studies pot

A WORLD WIDE REVIEW OF THE COMMERCIAL PRODUCTION OF BIODIESEL – A technological, economic and ecological investigation based on case studies pot

Ngày tải lên : 29/03/2014, 17:20
... Biodiesel: Basic facts the lubricant itself are the same The lower the friction, the higher the lubricity "58 In the case of diesel fuel, the fuel acts as a lubricant for the finely fitting parts ... pumped The engine cannot run at these temperatures This is not a new problem for diesel engine operators Petroleum -based diesel fuel also gels but at temperatures that are lower than for Biodiesel.72 ... 2.5241 Greenhouse gas (GHG) balance B2 The blend B2 is of interest primarily because of its lubricity properties The greenhouse gas benefits for this blend are very modest at 1% for the vegetable...
  • 164
  • 601
  • 3
Báo cáo khoa học: "SemTAG: a platform for specifying Tree Adjoining Grammars and performing TAG-based Semantic Construction" pptx

Báo cáo khoa học: "SemTAG: a platform for specifying Tree Adjoining Grammars and performing TAG-based Semantic Construction" pptx

Ngày tải lên : 31/03/2014, 01:20
... trees involved in the derivation(s) and performs on these the unifications prescribed by the derivation S EM TAG has been used to specify a core TAG for French, called SemFRag This grammar is currently ... elementary trees For instance in figure 1, the variables x and y appear both in the semantic representation associated with the tree for aime (love) and in the tree itself Given such a TAG, the semantics ... Entries of Gand G ′′ are indexed using the same key We generate a tabular syntactic parser for G ′ using the DyALog system of (de la Clergerie, 2005) This parser is then used to compute the derivation...
  • 4
  • 203
  • 0
Báo cáo khoa học: " Systematisation of spatial uncertainties for comparison between a MR and a CT-based radiotherapy workflow for prostate treatments" pptx

Báo cáo khoa học: " Systematisation of spatial uncertainties for comparison between a MR and a CT-based radiotherapy workflow for prostate treatments" pptx

Ngày tải lên : 09/08/2014, 10:20
... the transport in it self does therefore not prolong the procedure ging The magnitude of the sagging was investigated using a set of 15 kg bricks which were distributed to approximate the weight ... Correction for weight The calibration vector was measured without load Therefore there is a need to correct for the sagging of the treatment table under the weight of the patient We found that the sagging ... over the treatment period The systematic and random uncertainty should be given different weight in the formation of margins between the CTV and the PTV In the present work we used the weight...
  • 9
  • 322
  • 0
Báo cáo y học: " The sequence of the CA-SP1 junction accounts for the differential sensitivity of HIV-1 and SIV to the small molecule maturation inhibitor 3-O-{3'''',3''''-"</h1> <p style="font-size:11px;margin-bottom:3px;">Chia sẻ: <a href="http://tailie

Báo cáo y học: " The sequence of the CA-SP1 junction accounts for the differential sensitivity of HIV-1 and SIV to the small molecule maturation inhibitor 3-O-{3'''',3''''-"</h1> <p style="font-size:11px;margin-bottom:3px;">Chia sẻ: <a href="http://tailie

Ngày tải lên : 13/08/2014, 13:20
... Primers used to produce SIVm2 were: GAAGGCTCGAGTACTGGCAGAAGCCATGAAAGAG (sense) and GGCTTCTGCCAGTACTCGAGCCTTC (antisense) Primers used to produce SIVm3 were: GAAGGCTCGAGTACTGGCAGAAGCCATGAAAGAG (sense) ... CATAAAGCGCGCCTTATGGCTGAAG (sense mutagenic primer) and TAAGGCGCGCTTTATGGCCGGG (antisense mutagenic primer) The PCR product was digested with SpeI and ApaI and used to replace the corresponding fragment in pNL4-3 ... the CA and CA- SP1 bands in the pulse-chase assays of Gag processing shown in Fig Quantitative analysis of the 35S levels in the CA and CA- SP1 bands in the pulse-chase assays of Gag processing...
  • 10
  • 194
  • 0
Báo cáo hóa học: " CSMA/CCA: A Modified CSMA/CA Protocol Mitigating the Fairness Problem for IEEE 802.11 DCF" docx

Báo cáo hóa học: " CSMA/CCA: A Modified CSMA/CA Protocol Mitigating the Fairness Problem for IEEE 802.11 DCF" docx

Ngày tải lên : 22/06/2014, 22:20
... run the simulated system is typically run for a time period between 100 and 500 seconds 4.1 Performance measures To evaluate the network performance, we use five performance measures: throughput, ... for example, the CSMA/CCA protocol without reset yields the worst performance, and the CW size leakage does not help in this example, for example, the CSMA/CCA allowing leakage has worse performance ... MACAW [4] The paper is organized as follows In Section 2, the IEEE 802.11 DCF based on the CSMA /CA protocol is briefly outlined Design of the proposed CSMA/CCA protocol is presented in Section Then,...
  • 12
  • 302
  • 0
Function of Soils for Hum a n Societies and the Environment .The G e o l o g i c a l Society of L ppt

Function of Soils for Hum a n Societies and the Environment .The G e o l o g i c a l Society of L ppt

Ngày tải lên : 06/07/2014, 08:20
... fungi 89 BURGHARDT,W Soil sealing and soil properties related to sealing 117 WELLS, E C Cultural soilscapes 125 LANDA, E R From agricultural geology to hydropedotogy: forging links within the ... European distributor for selected publications of the American Association of Petroleum Geologists (AAPG), the Indonesian Petroleum Association (IPA), the Geological Society of America (GSA), the ... Society for Sedimentary Geology (SEPM) and the Geologists' Association (GA) Joint marketing agreements ensure that GSL Fellows may purchase these societies' publications at a discount The Society's...
  • 5
  • 287
  • 0
Báo cáo y học: "Subcutaneous Immunoglobulin-G Replacement Therapy with Preparations Currently Available in the United States for Intravenous or Intramuscular Use: Reasons and Regimens" docx

Báo cáo y học: "Subcutaneous Immunoglobulin-G Replacement Therapy with Preparations Currently Available in the United States for Intravenous or Intramuscular Use: Reasons and Regimens" docx

Ngày tải lên : 08/08/2014, 20:23
... indication of their size The results of this calculation for each of the patients is given in the rightmost column of the tables The mean for all of the patients, regardless of whether they used the 16% ... turn, suggested the use of smaller fractionated doses because the monthly dosage formerly given as a single large IV infusion might not be tolerated easily if given by the subcutaneous route Regardless, ... standard syringes, which may then be used with syringe driver pumps without the need for specialized reservoirs or filling equipment In general, 1.6 g doses are preferred for children and g doses...
  • 11
  • 420
  • 0