m liu x kunert o winkler na schinkovitz a schmiderer c novak j bauer r 2014 quot polyacetylenes from radix et rhizoma notopterygii incisi with an inhibitory effect on nitric oxide production in vitro quot planta med 80 5 pp 415 8

Tổng quan về tác dụng của 20 vị thuốc giải biểu và thuốc phát tán phong thấp

Ngày tải lên : 28/07/2015, 17:54

... 2,2-diphenyl-1-picrylhydrazyl FST Forced swimming test GM-CFS Granulocyte-macrophage colony-stimulating factor GOT (AST) Transaminase glutamic oxaloacetic (Aspartate transaminase) GPT (ALT) Transaminase glutamic ... Passive cutaneous anaphylaxis test PGE2 Prostaglandin E2 PPARα Peroxisome proliferator-activated receptor alpha PPARγ Peroxisome proliferator-activated receptor gamma TNF-α Tumor necrosis factor ... benzothiazoline-6-sulphonic acid) ALP Alkaline phosphatase AMPK 5 -AMP-activated protein kinase CCl Cacbon tetraclorua CIA Collagen-induced arthritis COX-1 Cyclooxygenase-1 COX-2 Cyclooxygenase-2 DPPH 2,2-diphenyl-1-picrylhydrazyl...

132
1.9K
3

Báo cáo y học: "Toxic effects of methoxychlor on the episodic prolactin secretory pattern: Possible mediated effects of nitric oxide production" pdf

Ngày tải lên : 10/08/2014, 09:20

... F, Lara JI, Lorenzo MJ, Maldonado G, Cacicedo L: Direct action of serotonin on prolactin, growth hormone, corticotrophin and luteinizing hormone release in cocultures of anterior and posterior ... episodic prolactin secretion and on dopamine concentration, the comparison of values was done by oneway analysis of variance (ANOVA) Finally, to test the existence of an interaction between MTX and ... González-Carracedo A, Romero A, Cabaleiro T, Esquifino AI: Toxic effects of cadmium on the regulatory mechanism of dopamine and serotonin on prolactin secretion in adult male rats Toxicol Lett 20 05, 155 :87 -96...

9
528
0

Báo cáo y học: "Extrapulmonary effects of nitric oxide inhalation therapy: time to consider new dosing regimes" docx

Ngày tải lên : 13/08/2014, 08:21

1
151
0

Báo cáo khoa học: In vivo degradation of nitric oxide synthase (NOS) and heat shock protein 90 (HSP90) by calpain is modulated by the formation of a NOS–HSP90 heterocomplex pot

Ngày tải lên : 30/03/2014, 04:20

... interactions controlling nitric oxide synthases Acta Physiol Scand 1 68, 27–31 Gratton J, Fontana J, O Connor D, Garcia-Cardena G, McCabe T & Sessa C (2000) Reconstitution of an endothelial nitric- oxide ... Averna M, Salamino F, Cantoni C, Mingari MC, Prato C, Pontremoli S & Melloni E (2006) Characterization of the calpain ⁄ calpastatin system in human hemopoietic cell lines Arch Biochem Biophys 456 , ... (19 98) Properties of calpastatin forms in rat brain FEBS Lett 431, 55 58 36 Pontremoli S, Melloni E, Damiani G, Salamino F, Sparatore B, Michetti M & Horecker BL (1 988 ) Effects of a monoclonal anti-calpain...

11
344
0

Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt

Ngày tải lên : 18/02/2014, 14:20

... with plasma membranes and other hydrophobic cellular organelles The theoretical helical wheel conformation of HNr shows the basic and hydrophobic or neutral amino acids on opposite surfaces of ... molecule (Fig 1B) Such an arrangement of basic and hydrophobic groups was reported to be a good prediction factor for the antimicrobial activity of model [24] and naturally occurring cationic ... secreted from amnion epithelial cells [11] A recent report indicated that activated human neutrophils contain and release chromatin and nuclear proteins such as histone H 2A that together form extracellular...

12
756
0

RESPIRATORY HEALTH EFFECTS OF PASSIVE SMOKING: LUNG CANCER AND OTHER DISORDERS ppt

Ngày tải lên : 15/03/2014, 01:20

... DISCLAIMER This document has been reviewed in accordance with U.S Environmental Protection Agency policy and approved for publication Mention of trade names or commercial products does not constitute ... School of Medicine, Piscataway, NJ 08 85 4 (1992 review only) Dr Jonathan M Samet, Professor of Medicine, Department of Medicine, University of New Mexico School of Medicine, and New Mexico Tumor ... 3- 28 Range of average RSP mass concentrations and range of maximum and minimum values measured by different indoor environments for smoking occupancy from studies shown in Figure 3 -5 ...

20
377
0

Effects of white rice, brown rice and germinated brown rice

Ngày tải lên : 15/03/2014, 15:33

... AGGTGACACTATAGAATAGATCATTGCTCCTCCTGAGC AGGTGACACTATAGAATAAAGGTGAAGGTCGGAGTCAA AGGTGACACTATAGAATACACACGGCTCACATTGCAT GTACGACTCACTATAGGGAAAAGCCATGCCAATCTCATC GTACGACTCACTATAGGGAGATCTCGCTCCTGGAAGATG ... universal tag) Forward Reverse AGGTGACACTATAGAATAGCTCAGCTGACACAGTTCGT AGGTGACACTATAGAATACAAGCGTGACTTTGGGTCTT GTACGACTCACTATAGGGACCATTCGCATTAACCAGCTT GTACGACTCACTATAGGGAGGGCTTCACTTCTTGCAAAC AGGTGACACTATAGAATAGATCATTGCTCCTCCTGAGC ... (K2S 2O8 ), sodium carbonate (Na2 CO3), γ-aminobutyric acid (GABA) standard, trolox standard, gallic acid standard, Folin–Ciocalteu reagent, and streptozotocin (STZ) were all purchased from Sigma-Aldrich...

18
389
2

Effects of simultaneous doping with boron and phosphorous on the structural, electronic and optical properties of silicon nanostructures

Ngày tải lên : 16/03/2014, 15:15

... decrease on increasing the diameter of the Si-nc This is due to the fact that for larger nanocrystals the excitation determines a minor distortion of the geometry Concerning the second parameter, ... which are the parameters that play an important role in the determination of the FE, we have performed a series of total energy calculations considering: (i) single-doped and codoped nanocrystals, ... siliconbased microelectronics Moreover, the possibility to tailor their electronic properties by changing thickness, orientation, surface morphology and doping is another important point in their...

8
1K
0

effects of flower - like, sheet - like and granular sno2 nanostructures

Ngày tải lên : 19/03/2014, 16:48

... depends on the rate of nucleation and growth It is also thought that adding inorganic salts causes to reduce the overall reaction rate and broaden the distribution of product NaBr, NaCl, and NaF as ... PRESS A. A Firooz et al / Materials Chemistry and Physics xxx (20 08) xxx–xxx to cause cage-like shells surrounding the SnO particles, preventing their growth of nanoparticles Adjacent nanoparticles ... temperature of which was accurately controlled by a PID temperature controller The sensor was connected to an electrical circuit using platinum electrodes The DC electrical measurement was made...

4
325
0

The Health Effects of Air Pollution: Separating Science and Propaganda pptx

Ngày tải lên : 29/03/2014, 18:20

... is a major cause of asthma For example, according to the Carolinas Clean Air Coalition (CCAC), a Charlottebased environmental group, “1/3-1/2 of all asthma in North Carolina is due to air pollution.” 15 ... Ambient Air and Mortality: Toxicologic Perspectives.” 54 Q Sun, A Wang, X Jin et al., “Long-Term Air Pollution Exposure and Acceleration of Atherosclerosis and Vascular Inflammation in an Animal Model,” ... shorthand for airborne soot and dust up to 2 .5 micrometers in diameter One micrometer is one-millionth of a meter, or one- 25, 000th of an inch Trends in these and other pollutants were determined from...

22
478
0

Looking at the label and beyond: the effects of calorie labels, health consciousness, and demographics on caloric intake in restaurants

Ngày tải lên : 08/04/2014, 18:33

... Conscious Consumer J Health Care Mktg 1993, 13: 18 25 Berning JP, Chouinard HH, McCluskey JS: Consumer Preferences for Detailed versus Summary Formats of Nutritional Information on Grocery Store ... options consisted of more than 80 0 calories Diners could choose from 51 menu options Major menu categories included soups and salads, burgers and sandwiches, pasta, vegetarian items, and prime and ... demographics on caloric intake in restaurants International Journal of Behavioral Nutrition and Physical Activity 2013 10:21 Author details University of Illinois at Urbana-Champaign, 321 Mumford...

9
420
0

báo cáo hóa học:" The effects of stochastic resonance electrical stimulation and neoprene sleeve on knee proprioception" doc

Ngày tải lên : 20/06/2014, 01:20

... Journal of Orthopaedic Surgery and Research 2009, 4:3 Background Proprioception is the conscious and unconscious awareness of body limb position and movement Proprioception is traditionally measured ... multifunction DAQ card, two analog stimulus isolation boxes, two error isolation boxes, and two pairs of surface electrodes Electrode pairs (stimulator and ground) were placed approximately cm above ... control condition absolute error (independent variable) To determine whether the application of electrical stimulation had any lasting effects on the errors of the control condition, a one-way...

9
506
0

Báo cáo hóa học: " Genetic diversity and silencing suppression effects of Rice yellow mottle virus and the P1 protein" doc

Ngày tải lên : 20/06/2014, 01:20

... polyclonal antiserum against an isolate from Madagascar (RYMV-Mg) Positive reactions were detected after incubation with alkaline phophatase-conjugated polyclonal antibody to RYMV and substrate, ... to RNA from L10 either NI (non-inoculated) or BI (buffer-inoculated) and RNA from non transgenic Tai, or transgenic L4 plants as negative controls EtBr staining of rRNA served as a loading control ... different RNAs, microRNAs (miRNA) and small-interfering RNAs (siRNA), have been characterized [3] RNA-dependent RNA polymerase activity (RdRP) leads to production of dsRNAs molecules that are recognized...

12
384
0

Báo cáo khoa học: "Immunostimulatory effects of anionic alkali mineral complex solution Barodon in porcine lymphocytes " potx

Ngày tải lên : 07/08/2014, 14:23

... Recently, anionic alkali mineral complex solution, Barodon, was introduced to animal farms to improve the productivity The composition and characteristics of Barodon are based on minerals including ... Creemers, P C Determination of co-expression of activation antigens on proliferating CD4+, CD4+CD8+ and CD8+ lymphocyte subsets by dual parameter flow cytometry J Immunol Methods 1 987 , 97, 1 65- 171 ... C and MartinezMoreno, A Immunohistochemical study of the local immune response to Fasciola hepatica in primarily and secondarily infected goats Vet Immunol Immunopathol 19 98, 24 Byung Woo Yoo...

10
346
0

Báo cáo lâm nghiệp: "The effects of elevated CO 2 and water stress on whole plant CO 2 exchange, carbon allocation and osmoregulation in oak seedlings" docx

Ngày tải lên : 08/08/2014, 18:21

... Osmotic adjustment is commonly associated with starch breakdown and concomittant increase in low molecular weight organic solutes (Tyree and Jarvis, C 1 982 ; Morgan, 1 984 ) Preliminary 13 NMR spectrometry ... different plant components and increased organic solute concentrations However, elevated CO concentrations often lead to reduced total mineral ion concentrations in the plant tissues (Conroy, ... reduced mineral solute concentrations may offset the increase in organic solute remains open Quercus robur L acorns were collected in the Forêt Domaniale de Manoncourt (Meurthe et Moselle, eastern...

13
284
0

Báo cáo khoa học: "Long-term effects of culture establishment from shoot-tip explants in micropropagating oak (Quercus robur L)" pdf

Ngày tải lên : 08/08/2014, 19:21

... Micropropagation in vitrode Cynara scolymus: conséquences bactériologiques In: Application de la culture in vitro l’amélioration des plantes fourragères, Eucarpia, Versailles, France, 8- 13 Monteuuis ... from one of the sourceplants growing under natural conditions, while all attempts to establish cultures from nodal explants of these plants failed because of contamination Comparison of cloning ... of antibiotic treatments and shoot-tip culture on bacterial decontamination of an in vitro propagated clone of hybrid walnut (Juglans nigra x J regia) Biol Plant 31, 269-2 75 Moncousin Ch (1 980 ) ...

8
240
0

$Báo cáo y học: "Protective effects of total fraction of avocado/soybean unsaponifiables on the structural changes in experimental dog osteoarthritis: inhibition of nitric oxide synthase and matrix metalloproteinase-13" docx$

Báo cáo y học: "Protective effects of total fraction of avocado/soybean unsaponifiables on the structural changes in experimental dog osteoarthritis: inhibition of nitric oxide synthase and matrix metalloproteinase-13" docx

Ngày tải lên : 09/08/2014, 14:20

... study protocol was approved by the institutional ethics committee and conducted in accordance with the Canadian Council on Animal Care guidelines Macroscopic grading Immediately after sacrifice, ... pre-emptive analgesic protocol based on opioid (fentanyl patch 75 μg [Janssen-Ortho, Markham, ON, Canada] and meperidine mg/kg subcutaneous injection [Sandoz, Montreal, QC, Canada]) and intra-articular ... Representative sections and data of the superfiimmunostaining cial zone of articular cartilage from placebo-treated and ASU-treated dogs (original magnification ×100) Morphometric analysis of iNOS immunostaining...

9
547
0

Báo cáo khoa học: "Pharmacokinetics and Pharmacodynamic Effects of Flunixin after Intravenous, Intramuscular and Oral Administration to Dairy Goats" pptx

Ngày tải lên : 12/08/2014, 15:20

... High-performance liquid chromatography method for determination of flunixin in bovine plasma and pharmacokinetics after single and repeated doses of the drug, American Journal of Veterinary Research, ... Hadi AA Elghazali M, 159 Zorob O, Alkatheeri NA, Barezaiq IM: Pharamcokinetics, metabolism and urinary detection time of flunixin after intravenous administration in camels Journal of Veterinary ... Data after intravenous administration are shown as a reference Acta vet scand vol 44 no 3-4, 2003 Pharmacokinetics and pharmacodynamic effects of flunixin 157 Table Pharmacokinetic parameters (median...

7
381
0

Báo cáo y học: ""Shock and kill" effects of class I-selective histone deacetylase inhibitors in combination with the glutathione synthesis inhibitor buthionine sulfoximine in cell line models for HIV-1 quiescence" doc

Ngày tải lên : 12/08/2014, 23:21

... 30:99-110 Rahman I, Marwick J, Kirkham P: Redox modulation of chromatin remodeling: impact on histone acetylation and deacetylation, NF-kappaB and pro-inflammatory gene expression Biochem Pharmacol ... liquid chromatography/tandem mass spectrometry assay to quantitate MS-2 75 in human plasma J Pharm Biomed Anal 2007, 43: 784 - 787 Lacreta FP, Brennan JM, Hamilton TC, Ozols RF, O' Dwyer PJ: Stereoselective ... disease Antioxid Redox Signal 2000, 2 :55 1 -57 3 Fraternale A, Paoletti MF, Casabianca A, Nencioni L, Garaci E, Palamara AT, Magnani M: GSH and analogs in antiviral therapy Mol Aspects Med 20 08, 30:99-110...

10
418
0

Báo cáo y học: "Effects of thoraco-pelvic supports during prone position in patients with acute lung injury/acute respiratory distress syndrome: a physiological study" potx

Ngày tải lên : 12/08/2014, 23:23

... Falke K, Hudson L, Lamy M, LeGall JR, Morris A, Spragg R: Report of the AmericanEuropean consensus conference on ARDS: definitions, mechanisms, relevant outcomes and clinical trial coordination ... production, partial pressure of CO2 in mixed expired air, and end-tidal concentration of carbon dioxide were measured with a respiratory function monitor (CO2SMO™; Novametrix Medical Systems Inc., Wallingford, ... tensions in the arterial and central venous blood were analysed with a blood gas analyzer (IL-1312 Blood Gas Manager; Instrumentation Laboratory, Milan, Italy) Minute metabolic carbon dioxide production, ...

9
357
0