log in as root and open a terminal window shut down the system to run state 0 then boot it
báo cáo khoa học:" Circulating Immune Complexes and trace elements (Copper, Iron and Selenium) as markers in oral precancer and cancer : a randomised, controlled clinical trial" pot
... http://www.head-face-med.com/content/2/1/33 0. 20 0.18 0. 16 0. 14 CIC 0. 12 0. 10 0 .08 0. 06 0. 04 0. 02 0. 00 70 80 90 100 1 10 1 20 Copper level 1 30 1 40 1 50 1 60 Figure Correlation between CIC and copper in the cancer group Correlation between ... chewing and associated habits The mean age was higher in the patients suffering from oral carcinoma Gross et al [29] reported that ageing is associated with a decline in the cell mediated immunity ... 10- 13)} The mean CIC levels were 0. 07, 0. 10 and 0. 03 OD4 50 in the precancer, cancer and normal group respectively There was a marked increased in the precancer and cancer patients The p value 5.67...
- 10
- 317
- 0
REPRODUCTIVE, MATERNAL AND CHILD HEALTH IN EASTERN EUROPE AND EURASIA: A COMPARATIVE REPORT ppt
... Disease Control and Prevention and ORC Macro 200 3 Reproductive, Maternal and Child Health in Eastern Europe and Eurasia: A Comparative Report Atlanta, GA (USA) and Calverton, MD (USA) TABLE ... as the USAID health officer in Romania and then as the Chief of the Health Reform and Humanitarian Assistance Division of the E&E Bureau in Washington D.C I observed that the health of women in ... Caucasus (Armenia, Azerbaijan, and Georgia), and Central Asia (Kazakhstan, Kyrgyz Republic, Turkmenistan, and Uzbekistan) These countries share a great deal in the way of recent political and...
- 15
- 314
- 0
Báo cáo " Teaching efl writing in Vietnam: Problems and solutions - a discussion from the outlook of applied linguistics " doc
... since reading and writing go hand in hand Learners will be motivated to write when they obtain necessary vocabulary, grammar and writing style through reading passages Particularly, as suggested ... and meaning is instantiated through language use Grabe and Kaplan [5] also emphasize that only teachers who understand theory and make a transition from theory to practice can make the most appropriate ... writing in Vietnam Defining and Tackling the Problems of Teaching and Learning EFL Writing Generally, as Grabe and Kaplan [5] discuss, language teachers in a writing course should be motivated...
- 6
- 704
- 1
Thesis: Directness in conversations in american english and vietnamese A comparative study
... Mark and Diep The example in involves a recently married Vietnamese woman and her mother -in- law As a custom, the young woman and her husband would live in the same house with her parents -in- law ... leave the table and sit in the living room? (Deena and Mara, 1982, p 21) In addition, Marcyliena (1998) defines directness in conversations as the absence of indirection and audience collaboration ... was gathered from the worms‟ cocoons and spun; how (speaking even faster) the brocade was woven with gold and silver threads and then embroidered, too; and how (speaking faster still) robe was...
- 53
- 623
- 3
Báo cáo lâm nghiệp: "Macronutrients in tree stems and foliage: a comparative study of six temperate forest species planted at the same sites" pps
... 0. 000 0. 013 0. 000 0. 023 0. 000 0. 0 50 0 .03 2 ns P 0. 012 ns 0. 018 ns 0. 000 0. 000 0. 000 0. 001 K 0. 000 ns 0. 001 ns 0. 000 ns 0. 000 ns Ca 0. 000 0. 035 0. 001 ns 0. 000 ns 0. 000 Mg 0. 001 ns 0. 003 ns 0. 000 ... 0. 000 ns S 0. 000 ns 0. 000 ns 0. 000 ns All species Species Deciduous species only Site Species Site ns 0. 000 0. 047 0. 000 ns 0. 000 ns 0. 000 ns 0. 000 ns 0. 001 ns ns 0. 000 ns 0. 003 0. 000 ns ns 0. 000 ... (0. 17) 2 .00 (0. 24) 0. 24 (0. 04) 0. 15 (0. 01) bc 1.71 (0. 31) 1. 70 (0. 04) Ca 1. 10 (0. 13) 0. 09 (0. 01) 0. 56 (0. 08) 1.24 (0. 34) 0. 21 (0. 06) 0. 09 (0. 01) bc c K 1.13 (0. 00) 0. 13 (0. 04) 1 .07 (0. 12) 1 .01 ...
- 10
- 443
- 0
Báo cáo y học: "PTPN22 polymorphism and anti-cyclic citrullinated peptide antibodies in combination strongly predicts future onset of rheumatoid arthritis and has a specificity of 100% for the disease" ppsx
... City, CA, USA) The forward primer was 5'-CAACTGCTCCAAGGATAGATGATGA-3 'and the reverse primer was5'-CCAGCTTCCTCAACCACAATAAATG-3' The probes were labelled at their 5' ends with FAM™ (the C allele) and ... between the PTPN22 1858T variant and a disease related autoantibody, and that they co-operate to increase the relative risk of developing an autoimmune disease, in this case RA Our data suggest that ... joint disease The mean age at the onset of disease was 56 .0 years (range 37 to 68 years) At the time of the study, the median disease duration since diagnosis was 3 .0 years (interquartile range...
- 6
- 322
- 0
báo cáo khoa học:" Quality of life among patients receiving palliative care in South Africa and Uganda: a multi-centred study" ppt
... physical symptoms It is vital to identify and meet the psychological and spiritual care needs of patients, as well as to assess and manage pain and other symptoms and functional limitations in this ... Health 200 3, 3:33 11 Ministry of Health RoU: National Sector Strategic Plan 200 0 /01 - 200 4 /05 Kampala, Ministry of Health; 200 0 12 Jagwe J, Merriman A: Uganda: Delivering Analgesia in Rural Africa: ... Missoula Vitas Quality of Life Index (MVQOLI), a 26-item measure originally developed and validated in the USA [43], was administered by Namisango et al to 200 patients with advanced AIDS in urban...
- 14
- 229
- 0
báo cáo khoa học: " Traditional agroecosystems as conservatories and incubators of cultivated plant varietal diversity: the case of fig (Ficus carica L.) in Morocco" ppsx
... 156-1 90 0.599 0. 602 0. 008 0. 8 80 MFC 3a 96-136 0. 818 0. 7 60 -0. 074 0. 851 MFC 4a 216-226 0. 524 0. 493 -0. 0 60 0.652 MFC8b 173-177 0. 508 0. 4 90 -0. 033 0. 619 MFC9b 188-211 0. 636 0. 582 -0. 0 90 0.786 MFC11b ... flora [3] It is the largest biodiversity hotspot on earth (over 2 ,00 0 ,00 0 km2) and it includes several separate refuge areas [ 10] Traditional agroecosystems are still found all over the Mediterranean ... is associated with a major pattern of biodiversity: it increases close to the equator, and decreases towards the poles [8] Two main ideas have been suggested to explain this global biodiversity...
- 12
- 344
- 0
Báo cáo y học: "Homeostatic mechanisms in dopamine synthesis and release: a mathematical model" pptx
... cda, eda) has the following properties: at the normal steady state it equals one; as eda gets large it approaches 0. 5; as eda gets smaller and smaller it approaches The exponent was chosen to approximate ... Habituation to increased firing Habituation to increased firing At one hour, the firing rate of the neuron is increased from Hz to 15 Hz and eda immediately triples Then eda gradually decreases to an intermediate ... interpretations and conclusions, and the writing and editing of the manuscript All authors read and approved the final manuscript Acknowledgements The authors thank Marc Caron and Raul Gainetdinov...
- 20
- 367
- 0
INTUITION USE IN FOOT, THOMSON, AND KAMM a CASE STUDY
... so fascinating about it And it can take a while You can develop a whole theory about what is causing you to have an aesthetic judgement, and the same can be said about judgements in moral cases ... certain about These are supposed to be clear cases At any rate, over time in the philosophical literature, the situation involving the "runaway tram" in case 1B became known as the Trolley case, and ... carefully crafted to make certain things especially stark As Foot puts it, the cases are designed to "isolate" certain things (Foot 1967: 1) These cases are certainly not imagined at random, and...
- 90
- 249
- 0
Chasing the negawatt energy efficiency in british homes and businesses a policy perspective
... Power had just announced a 19% increase in its gas tariff and a 10% increase in its electricity price Accordingly, 80% of consumers say that reducing their bills was the sole or strong motivator ... with half of all firms polled last year noting the issue as a high priority for them This year, that priority has waned to three in ten, although another 40% say it is a moderate priority In part, ... is a useful start The Energy Saving Trust estimates that just leaving gadgets and appliances on standby in homes wastes some £ 900 m of energy annually8 Inevitably, interest falls as more substantial...
- 24
- 251
- 0
Time and performance a three part study examining the relationships of job experience, organizational tenure, and age with job performance
... to 0. 39 0. 03 0. 03 Productivity 27 37 21,935 -0. 30 to 0. 38 0. 08 0. 09 Supervisory Rating White 78 115 58,281 -0. 36 to 0. 39 0. 01 0. 01 75 97 50, 727 -0. 36 to 0. 38 0. 02 0. 02 Blue 20 44 26,254 -0. 36 to ... tenure/performance relationship, an increase in a sample’s tenure by one year was associated with a decrease in the relationship with performance by 0. 013 (p < 01 ) For age, an increase of one year of a sample’s ... was approximated as job tenure; however, this was not always the case, and in two studies the mean experience of the sample was greater than the mean organizational tenure of the sample As the...
- 44
- 429
- 0
Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt
... Sequence (residues 91– 100 ) WT polyAla AGG GAG GGA GAA AGA AAG GGD GGE GGL GGN GGS GGP GGGAGGGGGG *SA*AAAAA* AAA******* ****AAA*** *******AAA ****AAAAAA AAA****AAA AAA*AAA*** *******DDD *******EEE ... keeps a preprotein from binding mtHsp 70 in the mitochondrial matrix [17] Another amino acid repeat that was shown to disrupt the interaction of a preprotein with mtHsp 70 was that of glutamic acid ... Transit peptide of Toc75 A J Baldwin and K Inoue Fig The biogenesis of pea Toc75 The precursor, intermediate, and mature forms of Toc75 are indicated as prToc75, iToc75, and mToc75 with the...
- 9
- 496
- 0
Báo cáo khoa học: Synechocystis DrgA protein functioning as nitroreductase and ferric reductase is capable of catalyzing the Fenton reaction potx
... dinoseb and nitrofurazone were used as substrates at a final concentration of 100 lm each In the case of cytochrome C, the concentration was set to 50 lm and absorbance was measured at 5 50 nm The ... was prewarmed to 30 °C and placed in a micro black-cell and set into a spectrophotometer (Hitachi U- 300 0) NAD(P)H oxidation measurement was immediately started at 3 40 nm, and substrates were added ... reductase as the second highest score after nitroreductase Indeed in this study it was demonstrated that DrgA protein has a reductase activity to flavin as well as to nitroaromatic compounds Flavin reductases...
- 10
- 338
- 1
Báo cáo hóa học: " EQ-5D visual analog scale and utility index values in individuals with diabetes and at risk for diabetes: Findings from the Study to Help Improve Early evaluation and management of risk factors Leading to Diabetes (SHIELD)" potx
... members) 0. 43 0. 53 0. 59 0. 64 (reference) - 0. 009 † - 0. 018† - 0. 0 10 - 0. 022† 0. 004 0. 005 0. 005 0. 006 Body mass index (kg/m2) group 1.43 0. 46 0. 47 - 0. 017 (reference) - 0. 007 - 0. 047† 0. 013 0. 004 0. 004 ... 0. 029† 0. 026† 0. 021† 0. 023† 0. 015† - 0. 002 0. 014† 0. 011 (reference) 0. 007 0. 005 0. 005 0. 006 0. 005 0. 007 0. 006 0. 007 ≥5 (reference) - 0. 77 - 1.68† - 1 .05 - 2.52† Underweight Normal weight Overweight ... 0. 011† - 0. 031† 0. 008 0. 006 Female Male - 1.16† (reference) 0. 32 - 0. 029† (reference) 0. 003 White Black Other (reference) 1. 20 - 1.66
- 7
- 611
- 1
báo cáo khoa học: " Gene-based SSR markers for common bean (Phaseolus vulgaris L.) derived from root and leaf tissue ESTs: an integration of the BMc series" docx
... motifs1 ac/gt/ca/tg 11.1 10. 0 0. 0 11.1 7 .0 ag/ct/ga/tc 88.9 50. 0 85 .0 61.1 71.9 at/ta 0. 0 40. 0 15 .0 27.8 21.1 gc/cg 0. 0 0. 0 0. 0 0. 0 0. 0 aag/aga/gaa/ttc/tct/ctt 11.8 25 .0 30. 4 30. 8 23.2 aat/ata/taa/tta/tat/att ... sequencing and hybridization based approaches performed equally well in distinguishing Andean and Mesoamerican genepools and the Argentinean, Colombian and Mexican wild beans as separate accessions ... 1-368 The Andean and Mesoamerican genepools are indicated in each case with a subdividing dark line that separates the dendograms in two and with different shades of circles at the end of the branches...
- 10
- 330
- 0
Báo cáo y học: "Effect of dexmedetomidine versus lorazepam on outcome in patients with sepsis: an a priori-designed analysis of the MENDS randomized controlled trial" doc
... inhibits proinflammatory mediators in the lipopolysaccharide-activated macrophage Anesthesiology 200 6, 105 : 105 -1 10 33 Lubick K, Radke M, Jutila M: Securinine, a GABAA receptor antagonist, enhances ... Ever vasoactive drugs increased 26% 47% 0. 08 33% 16% 0. 2 Sinus bradycardia (< 60 beats/min) 13% 6% 0. 4 24% 0% 0. 02 Sinus tachycardia (> 100 beats/min) 81% 84% 0. 7 52% 53% Mean (standard deviation) ... molecular targets (α2 adrenoceptors and gamma-aminobutyric acid type A (GABAA) receptors, respectively) and neural substrates for their hypnotic effects that may play a critical role in maintaining...
- 12
- 421
- 0
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
... AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT 1172 BUD6F CAGACCGAACTCGGTGATTT 1173 BUD6R TTTTAGCGGGCTGAGACCTA 1163 HSP12F AAGGTCGCTGGTAAGGTTCA 1164 HSP12R GCTTGGTCTGCCAAAGATTC ... BNA2 3' 1249 YKL161CR GCAATGTTTCCTCAGGTGGT GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC 1278 NPT1 5' 1166 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 108 4 CTT1F AAAGAGTTCCGGAGCGTGTA ... patterns are similar across the time course cluster together Pearson correlation was used as the similarity measure and average linkage as the clustering algorithm Expression levels are the averages...
- 17
- 432
- 0
Jiushi as a pragmatic marker evidence from the heart to heart radio program
... relation to the intonation unit within the more macro conversational structure: as an independent intonation unit, as iv an initiator of an intonation unit or elsewhere within an intonation unit As a ... an independent intonation unit, as an initiator of an intonation unit or elsewhere within an intonation unit As a free standing intonation unit, it can either occupy an entire conversational ... Throughout the data, I have identified three placements of jiushi relative to the intonation unit: as an independent intonation unit, as initiating an intonation unit and as part of an intonation unit...
- 132
- 469
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008