local expression of the midwest
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt
Ngày tải lên :
15/02/2014, 01:20
... to the catalytic site of the R1E subunit. As
reported in the Results, upon completion of substrate
conversion, the radical is then rapidly passed back
from the R1E subunit to the tyrosyl of the ... RNR and that of other class 1
RNRs or, instead, is a result of the interaction of the
R2F with the inactivated (oxidized) form of the R1E.
We consider the first option unlikely. Under these cir-
cumstances, ... recipient.
In the present study, we report data on homologous
expression of the nrdF gene of C. ammoniagenes strain
ATCC 6872. This is the first report of the successful
purification of high amounts of the...
- 14
- 872
- 0
Tài liệu Báo cáo Y học: Purification, characterization, cloning, and expression of the chicken liver ecto-ATP-diphosphohydrolase pot
Ngày tải lên :
22/02/2014, 04:20
... from that of the oviduct ecto-ATPDase.
Immunochemical staining demonstrates the distribution of
the ecto-ATPDase in the bile canaliculi of the chicken liver.
HeLa cells transfected with the chicken ... Besides oviduct and liver, the chicken ecto-
ATPDase is also present in the apical membranes of the
oxyntic-peptic cells [37]. The distribution of the ecto-
ATPDase on these epithelial cells is distinctly ... different from
theotherATPDaseintheE-ATPasefamily,theCD39s
[13,17,19].
Molecular cloning of chicken liver ecto-ATPDase
The results described above indicate that: (a) the enzymatic
properties of the chicken...
- 10
- 694
- 0
Tài liệu 2012 GREAT TASTE OF THE MIDWEST doc
Ngày tải lên :
22/02/2014, 05:20
... SHAMES | THE ROC 5 504-571-9807
TAXI SERVICE | UNION CAB | 608-242-2000
Union Cab of Madison Cooperative has been the of cial cab company of the
Great Taste of the Midwest for over a decade. The ... and enjoy the
bands as you wander about the park. The musicians here today are sharing
their gift with us and we hope you’ll enjoy them enough to seek them out in
local venues and add them to ... and unload along the frontage road near the park entrance.
2012 FESTIVAL ORGANIZERS AND STAFF
The Great Taste of the Midwest is not organized by professionals but if it
were, the organizers below...
- 66
- 318
- 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx
Ngày tải lên :
07/03/2014, 16:20
... processing of the
D. melanogaster
a
-F1-ATPase
transcript
The expression of the a-F1-ATPase gene during develop-
ment is coordinated with the expression of the nuclear-
encoded b-F1-ATPase gene and the ... under the control of the actin 5C
promoter. The GAGA factor stimulated at least threefold
the activity of the promoter in constructs )397/+86 and
)146/+86, but had no effect on the activity of the
construct ... similar activity in Schneider cells to the promoter of
the b-F1-ATPase gene [34] and 10-fold stronger than
the promoter of the gene encoding the catalytic subunit of
the mitochondrial DNA polymerase...
- 11
- 532
- 0
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf
Ngày tải lên :
07/03/2014, 16:20
... clearly
grouped the trout IL-11 with IL-11 molecules from
other species and separate from other members of the
IL-6 family.
In vivo expression of IL-11
RT–PCR was used to examine the expression of trout
IL-11 ... differ-
ences were a 26 bp insertion in the 5¢-UTR of the
cDNA and an insertion of 12 repeats with a consensus
of CCAATGATGATCCAAGAAATCCACACTACAG
(31 bp) in the 3¢-UTR of the cDNA sequence (Fig. 1).
A ... in the 5¢-UTR, and four potential
poly(A) signals were found in the 3¢-UTR (Fig. 1), two
of them just 14 or 23 bp upstream of the poly(A) tail.
The remaining two poly(A) signals were upstream of
the...
- 12
- 511
- 0
Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf
Ngày tải lên :
08/03/2014, 23:20
... gene for one of the proteolipid subunits of
V-ATPase. Expression of the cDNAs in the strain revealed
that four cDNAs from the six complemented the proton
transport activity into the vacuole, ... progress.
Isoforms of V-ATPase subunits have so far been reported
in higher plants as reviewed by Sze et al. [1], three isoforms
of the subunit a of mouse enzyme [22,23], four isoforms of
the proteolipid ... isoforms as observed
in higher plants V-ATPase. We have also isolated two
different cDNAs coding for the subunits A and B of
V-ATPase. The intracellular localization of these isoforms
and the...
- 8
- 391
- 0
Báo cáo khoa học: Cell type-specific transgene expression of the prion protein in Xenopus intermediate pituitary cells ppt
Ngày tải lên :
16/03/2014, 14:20
... suggesting that the
level of GFP–PrP
C
transgene expression was dependent
on the colour of the background of the animal. The
fusion protein was found only in the NIL and not in
the AL of black- and ... investigate the
intracellular fate of PrP
C
by examining for the first
time its biosynthesis in the secretory pathway of neuro-
endocrine cells in vivo and the effect of the transgene
expression of PrP
C
on ... physiological manipulation of the biosyn-
thetic and secretory activity of the melanotrope cell.
In this study, we combined the unique properties of
the melanotrope cell with the technique of stable Xen-
opus...
- 16
- 431
- 0
Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt
Ngày tải lên :
16/03/2014, 16:20
... present in the other
members of the APP superfamily, such as the absence of the
exon encoding the KPI domain and the lack of a second
heparin-binding domain [3,4,13,26].
Comparative analysis of the
Xenopus
and ... andmammalianAPLP2.
Overall, the high degree of conservation of APLP2 may
help the identification of functionally important domains
within this APP superfamily member.
Expression pattern of
Xenopus
APLP2 mRNA
The expression ... Martens
1
1
Department of Molecular Animal Physiology, Nijmegen Center for Molecular Life Sciences (NCMLS), University of Nijmegen,
the Netherlands;
2
Laboratory of Bioinformatics, Wageningen University, the Netherlands
The...
- 7
- 405
- 0
Báo cáo khoa học: Expression of the pyrG gene determines the pool sizes of CTP and dCTP in Lactococcus lactis doc
Ngày tải lên :
16/03/2014, 16:20
... may have
acted on the level of pyrG expression has been removed.
The strength of the feedback regulation of CTP on pyrG
expression, i.e. the elasticity of pyrG expression for the
CTP concentration ... pyrG expression of up to 250% of the wild-type
level (Fig. 4A). The results show that the feedback
inhibition of the CTP synthase enzyme is incomplete
in vivo. In conclusion, the homeostasis of the ... downstream of
synthetic promoters. Expression from pyrG in the wild
type is regulated by the concentration of CTP in the cell
by an attenuation mechanism in the 5¢-end of the pyrG
mRNA [6]. The primer...
- 8
- 489
- 0
Báo cáo khoa học: Gain of structure and IgE epitopes by eukaryotic expression of the major Timothy grass pollen allergen, Phl p 1 pdf
Ngày tải lên :
16/03/2014, 18:20
... particles
from grass pollens [10,11]. The small size of these sub-
cellular particles allows them to reach the deeper air-
ways and may explain the frequent occurrence of
heavy asthma attacks after rainfalls ... Spectrometer (ThermoQuest Inc.). The
spectra were deconvoluted using Thermo Finnigan’s xcali-
bur software and the spectra were also verified by hand cal-
culations of charge states. The proteolytic ... preincubation of patients’ sera with
small recombinant protein fragments suggesting the
importance of conformational IgE epitopes [25].
Therefore, we further tested the importance of struc-
tural...
- 11
- 355
- 0
Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx
Ngày tải lên :
16/03/2014, 23:20
... the intracellular segment of the b
1
subunit is
required for the interaction with the a subunit, probably a
crucial step for the regulation of channel properties.
The tissue distribution of the ... I
m
/I
max
obtained from the fit. All data points (E, F) correspond to the mean ± SEM of the averaged normalized currents for the
number of oocytes indicated. (G) Effect of b
1B
on the current amplitude of Na
V
1.2. ... peptide.
Functional expression of the human b
1B
subunit
with Na
V
1.2 in
Xenopus
oocytes
To explore the regulatory function of the human b
1B
subunit, we injected cRNA of human b
1B
,aswellascRNA
of the sodium...
- 9
- 415
- 0
Báo cáo khoa học: Functional expression of the quinoline 2-oxidoreductase genes (qorMSL) in Pseudomonas putida KT2440 pUF1 and in P. putida 86-1 Dqor pUF1 and analysis of the Qor proteins doc
Ngày tải lên :
17/03/2014, 10:20
... estimated from Hanes plots.
Determination of the metal contents of the Qor proteins,
and detection of the nucleotide moiety of the
molybdenum cofactor
The contents of molybdenum and iron were determined ... suggested the presence of the MCD form of the
pyranopterin cofactor; the CMP contents of the three
enzymes were similar.
Keywords: quinoline 2-oxidoreductase; molybdenum hydro-
xylase; expression ... catalyse the
synthesis and insertion of a cytidine dinucleotide cofactor
into recombinant Qor as suggested by the release of CMP
after hydrolysis of the enzyme, it appears that the assembly
of intact...
- 11
- 724
- 0
Báo cáo khoa học: Expression of the Pycnoporus cinnabarinus laccase gene in Aspergillus niger and characterization of the recombinant enzyme pdf
Ngày tải lên :
17/03/2014, 11:20
... followed by a
Mono Q column. All the characteristics of the recombinant
laccase are in agreement with those of the native laccase. This
is the first report of the production of a white-rot laccase in
A. ... Using the GLA s ignal
sequence instead of the laccase one, the laccase activity
reached a maximum of 7000 IUÆL
)1
, i.e. an increase of
80-fold as compared to the first construction.
Considering these ... these results, the expression vector pLac1-B
was selected to characterize the recombinant laccase from
A. niger .
Immunodetection of the recombinant laccase
and expression of the corresponding...
- 8
- 495
- 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
Ngày tải lên :
23/03/2014, 13:20
... of
the product of P450scc-mediated side-chain
cleavage of 7-DHC. (A) Spectrum of the
enzymatic side-chain cleavage of 7-DHC;
(B) spectrum of 7-DHP synthetic standard.
Ó FEBS 2004 P450scc in the ... respectively. The
methyl group in the s ide chain (21-CH
3
) gave the singlet at
2.12 p.p.m. because o f the presence of an adjacent keto
group at C-20. The signal of the methine proton (3aH) at the
secondary ... (Invitrogen),
and the isolation of RNA followed the manufacture’s
protocol. The synthesis of first-strand cDNA was per-
formed using the Superscript preamplification system
(Invitrogen). Either 5 lg of t otal...
- 11
- 475
- 0
Báo cáo Y học: Expression of the aspartate/glutamate mitochondrial carriers aralar1 and citrin during development and in adult rat tissues docx
Ngày tải lên :
24/03/2014, 04:21
... and whether these isoforms play
thesamerole.
To address the first of these questions, we have now
studied the expression of aralar1 and citrin throughout
mouse development and in tissues of the adult ... lines
[12,18], therefore it may compensate for the loss of citrin in
the kidney of patients with CTLN2. This raises a general
question of whether the two isoforms are expressed in the
same tissues ... embryos. Note the stronger expression of aralar1 in skeletal muscle, heart and neural tissue. Note also the basolateral localization of
the in situ hybridization signal in the cells of the gut. Abbreviations:...
- 8
- 432
- 0
