limitations of a single enzyme activity as an index of microbial activity
Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagicEscherichia coli: a case for EspB as an intrinsically less-ordered effector pptx
... pathogenesis EspB as an effector of actin filament reorganization The EspB (or EarB) gene product was first identified as an important factor in EPEC attachment [14] and later characterized as a ... 2403–2408 Hamaguchi M, Hamada D, Suzuki KN, Sakata I & Yanagihara I (2008) Molecular basis of actin reorganization promoted by binding of enterohaemorrhagic Escherichia coli EspB to a- catenin FEBS ... Iizumi Y, Sagara H, Kabe Y, Azuma M, Kume K, Ogawa M, Nagai T, Gillespie PG, Sasakawa C & Handa H (2007) The enteropathogenic E coli effector EspB facillitates microvillus effacing and antiphagocytosis...
- 7
- 333
- 0
Báo cáo khoa học: Coenzyme A affects firefly luciferase luminescence because it acts as a substrate and not as an allosteric effector pot
... intensity was attained (12 s) the formation of the inhibitory product antagonized by CoA has only began and the effect of CoA at that assay time was nil or a discrete activation (always less than 20%) ... not as strange as it seems to be and supports the theory that nowadays rey luciferase evolved from an ancestral acyl-CoA synthetase [1] Given the luciferase catalysed reactivity of CoA, the CoA ... acetyl-CoA preincubating it with ATP, acetate, MgCl2, acetyl-CoA synthetase and inorganic pyrophosphatase (PPase) Then, we conrmed that treated acetyl-CoA was no longer antagonist of L-AMP in bioluminescent...
- 11
- 475
- 0
Báo cáo khoa học: Human airway trypsin-like protease induces amphiregulin release through a mechanism involving protease-activated receptor-2-mediated ERK activation and TNF a-converting enzyme activity in airway epithelial cells doc
... References Yasuoka S, Onishi T, Kawano S, Tsuchihashi S, Ogawara M, Masuda K, Yamaoka K, Takahashi M & Sano T (1997) Purification, characterization, and localization of a novel trypsin-like protease found ... stimulated with PAR-2 AP (300 lM) for h (A) Total RNA was extracted, and quantitative real-time RT ⁄ PCR (TaqManTM) analysis was used to determine the amounts of AR and b-actin mRNA (B, C) ELISA was ... supernatant of NCIH292 cells and in the cellular lysates of NCI-H292 cells treated with the vehicle HAT or PAR-2 AP was measured as follows Anti-AR mAb (clone 12111.333, Genzyme) was used as a capture...
- 13
- 242
- 0
20 quotes to ring in a successful new year as an entrepreneur
... you have a natural aptitude for adventurous business risks, creating inventive ideas, filling a gap in consumer needs, Whether you are an aspiring or seasoned ...
- 23
- 131
- 0
Comparison of the obstetric anesthesia activity index with total delivery numbers as a single denominator of workload demand in Israeli maternity units doc
... than epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal or pre-operative consultation, and resident training) In ... (1) The ratio of the epidural and cesarean components of the OAAI (OAAI EPI and OAAI CD) was also calculated as follows: OAAICD/EPI = ( no of cesareans per yr *1.5 ) / ( no of epidurals per yr ... Obstetric anesthesia workload demand in Israel has increased due to both an increase in the requests for labor analgesia and a marked increase in the cesarean delivery rate We propose a new workload-driven...
- 14
- 610
- 0
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx
... epitopes assay Assay performance characteristics of the anti-SmD3 peptide (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating characteristic analysis ... peptide-based assay (99.8%; data not shown) Further studies are in progress to compare the assay performance of the anti-SMP assay with that of other commercially available anti-Sm immunoassays For ... from an east Indian patient, and one from an oriental patient The racial background of four patients was not known Of these patients, 13 were male and 86 female (in two the sex was unknown), and...
- 11
- 593
- 0
USING BRAND AS AN EFFECTIVE WEAPON TO COMPETE IN THE MARKET: A CASE STUDY OF NHAT LINH COMPANY
... managing and maintaining a mix of factors, both tangible and intangible to attract consumer loyalty (Stobart, 1994) BRAND BRAND Organizational Associations Brand Personality PRODUCT Country of ... (Aaker, 1996) 2.7 Strategic Brand Management Brand management is above all about balancing variety of inputs Balances have to be struck between the external market and internal capabilities of ... has paid attention to it The Company has an unclear management information system and lack of retailers and consumers database to manage the distribution network Nevertheless, the Company has...
- 67
- 974
- 0
The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning
... before, which are made of ceramic material, another device mainly made of wet textile band has been designed, manufactured and characterised It is basically a cotton band of 25 cm width and 1600 cm ... first rigorous analysis of the direct and indirect evaporative systems, considering both the advantages and disadvantages and indicating and establishing some basis about their design, was developed ... if air looses enthalpy, water would be heated Thus, in a process where air and water are in contact, water will always tend to adiabatic saturation temperature, as in the case of the adiabatic...
- 28
- 652
- 0
Tài liệu Báo cáo khoa học: Multi-targeted activity of maslinic acid as an antimalarial natural compound pdf
... Accordingly, an additional inhibition assay was performed using P falciparum protein extracts and including cathepsin D (an aspartic protease) and the aspartic protease inhibitor pepstatin A as controls ... inhibition assays The effect of MA on PLA2 (EC 3.1.1.4) activity was determined by using a secretory PLA2 assay kit (Cayman 2958 The use of MA as an antiparasitic agent is protected by a patent owned ... structure of the available inhibitors of cathepsin D [19], a lysosomal protease of mammalian cells, and chalcones and phenothiazines have been assayed as inhibitors of falcipain-2 [20,21] Inhibition of...
- 11
- 682
- 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc
... to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the cloning and sequencing of the gene encoding 4-amino-3-hydroxybenzoate ... coupled enzyme assay, the enzyme reaction product identified by GC-MS analysis, and the determination of released ammonia The coupled enzyme assay revealed the mechanism of the deamination reaction and ... NADPH, and glutamate dehydrogenase were from Wako Pure Chemicals (Osaka, Japan); meat extract (Extract Ehlrich) was from Kyokuto Seiyaku Kogyo (Osaka, Japan); and pentafluorophenylhydrazine was from...
- 7
- 613
- 1
Tài liệu Báo cáo khoa học: The SCO2299 gene from Streptomyces coelicolor A3(2) encodes a bifunctional enzyme consisting of an RNase H domain and an acid phosphatase domain pdf
... encode a bifunctional enzyme consisting of an RNase H domain and an APase domain The RNase H and APase activities of the full length SCO2299 protein depend on its N-terminal RNase H domain and C-terminal ... examined here is a bifunctional enzyme consisting of an RNase H domain and an APase domain, and it is a novel style in the Type RNase H family Experimental procedures Cells, plasmids, and materials ... It is also unclear exactly what the fusion between RNase H and APase means for living cells APase domain The C-terminal domain of the SCO2299 protein exhibits phosphatase activity at an acidic...
- 10
- 561
- 1
Báo cáo Y học: Restoring enzyme activity in nonfunctional low erucic acid Brassica napus fatty acid elongase 1 by a single amino acid substitution pdf
... high and low erucic acid lines of Brassica campestris and Brassica oleracea Plant Sci 162, 245–250 Ghanevati, M & Jaworski, J.G (2001) Active-site residues of a plant membrane-bound fatty acid ... [1-14C]18:1-CoA and malonyl CoA The results of the elongase activity assays are summarized in Table The elongase activity in WS-wt was low as expected, but the activity in the two mutated WS-SDM clones was ... Alteration of seed fatty acid composition by an ethyl methanesulfonate-induced mutation in Arabidopsis thaliana a ecting diacylglycerol acyltransferase activity Plant Physiol 108, 399–409 Bradford,...
- 7
- 381
- 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG ... acquisition and analysis software was used to quantify band intensities Antibodies were purchased from Tianjin Saier Biotech and Sigma-Aldrich 10 11 Statistical analysis Data are expressed as mean ± standard...
- 11
- 396
- 0
Báo cáo khoa học: Characterization of SCP-2 from Euphorbia lagascae reveals that a single Leu/Met exchange enhances sterol transfer activity pdf
... palmitic acid to the sample The values are mean ± SD from at least four different analyses Plant Type Ergosterol Palmitic Acid E lagascae E lagascae E lagascae E lagascae A thaliana A thaliana ... Viitanen et al Table Lipid-transfer activity of E lagascae and A thaliana SCP-2 mutants Normalized decrease in BODIPY-PC transfer rate mediated by different A thaliana and E lagascae SCP-2 mutants ... (5¢-ATG AAAGTTCAAGAGAAGATCAATCTC-3¢); ELM99 (5¢ATGAGGGGTGCTATGAAGATCAAGG-3¢); ATL100 (5¢-ATTAGGGGTGCGCTGAAGATCAAGG-3¢); ATL14L15F18 (5¢-AAATCCGATGCAATCCTGGACCTGCTG AAGGAATTTCTTTCCACCGACGCC-3¢) For...
- 15
- 391
- 0
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx
... suggesting that the increase of Luc activity by SA reflect the levels of transcription and translation of Hsp105, not due to an indirect effect of SA on the basal activity of Luc Enhancement of Luc activity ... such as Hsp10 5a and Hsp70 in various mammalian cells Enhancement of thermoresistance of cells by SA Upon exposure to a sublethal heat treatment, mammalian cells acquire transient resistance to a ... that SA induced the activation of HSF, the transcription of hsp genes and the accumulation of Hsps in various mammalian cells and a concomitant increase of thermoresistance of cells Thus, SA may...
- 8
- 470
- 0
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot
... biotinylated peptide was detected by the addition of H2O2 and o-phenylenediamine An equal volume of 2.5 n H2SO4 was added, and the absorbance at 492 nm was measured Detection of in situ TGase activity ... in the presence of TGase (A) and TGase (B) The amount of reaction product was determined by microtiter assay, and is represented as absorbance at 492 nm The square, circle and triangle represent ... Furutani Y, Kato A, Notoya M, Ghoneim MA & Hirose S (2001) A simple assay and histochemical localization of transglutaminase activity using a derivative of green fluorescent protein as substrate...
- 11
- 449
- 1
Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc
... Strassel, C., Baas, M.J., Salamero, J., ChasserotGolaz, S., Cazenave, J.P., De La Salle, C & Lanza, F (2001) Biosynthesis and intracellular post-translational processing of normal and mutant platelet ... presence of increasing concentrations of methotrexate Analysis of permeabilized cells by confocal microscopy revealed an intracellular pool of GPV with a granular appearance (Fig 1B) Analysis of culture ... Immunoprecipitation and SDS/PAGE Materials and cell lines The mAbs V.1 and V.5 against GPV, ALMA.12 against GPIba, ALMA.16 against GPIX and RAM.1 against GPIbb, were developed in our laboratory [19]...
- 7
- 363
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
Báo cáo khoa học: A novel, promoter-based, target-specific assay identifies 2-deoxy-D-glucose as an inhibitor of globotriaosylceramide biosynthesis docx
... Establishment of stable transfectants and the luciferase assay An aliquot of 0.4 lg of each plasmid was transfected into · 105 HeLa cells with lipofectamine2000 (Invitrogen, Carlsbad, CA, USA) according ... 14646–14652 Ishii A, Ohta M, Watanabe Y, Matsuda K, Ishiyama K, Sakoe K, Nakamura M, Inokuchi J, Sanai Y & Saito M (1998) Expression cloning and functional characterization of human cDNA for ganglioside ... (luciferase) was secreted into the culture medium A 50 lL aliquot of culture medium from each transfectant was used to measure luciferase activity The luciferase activity was measured using the Ready-To-GlowÔ...
- 12
- 303
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008