letter of invitation to a meeting
a letter of invitation
Ngày tải lên :
27/05/2015, 21:00
... writing - Go around and help sts if necessary IV Consolidation: - Ask sts to talk about what have just leant V Evaluation and saying goodbye - Give comment about sts attitude - Ask sts to exercise ... activities with us The party will have a lot of fun games, singing, dancing … + Say what foods and drinks will be served at the party Ex: There will be lots of special food and drinks ... book and prepare next part - Write their letter for their friends - Look at the board - Work in pairs and correct the mistakes in their writing - Talk about what have just leant - Listen to ...
- 2
- 315
- 0
Gradual phase and morphology transformation of Fe3O4nanoparticles to a - FeOOH nanorods in alcohol/water mediain the presence of surfactant F127
Ngày tải lên :
19/03/2014, 16:48
... 106:1878 doi:10.1021/jp015532w 26 Hashimotoa H, Yokoyamab S, Asaokaa H, Kusanoc Y, Ikedad Y, Senoe M, Takadaa J, Fujiia T, Nakanishia M, Murakami R (2007) J Magn Magn Mater 310:2405 doi:10.1016/j.jmmm.2006.10.793 ... of the samples prepared in alcohol/water media with various volume ratios of alcohol to water: (a) 0:1, (b) 1:1, (c) 5:1 Fig TEM images of the samples prepared in alcohol/ water media with various ... show amorphous precipitate was obtained instead of a- FeOOH nanorods in alcohol/water media (5:1) without F127 Obviously, F127 plays an important role in the formation of a- FeOOH nanorods as a structuredirecting...
- 4
- 658
- 0
báo cáo hóa học:" Research Article Existence of Solutions to a Nonlocal Boundary Value Problem with Nonlinear Growth" pptx
Ngày tải lên :
21/06/2014, 11:20
... them a problem at nonresonance Nonlocal boundary value problems were first considered by Bicadze and Samarski˘ ı and later by Il’pin and Moiseev 2, In a recent paper , Karakostas and Tsamatos ... References A V Bicadze and A A Samarski˘, “Some elementary generalizations of linear elliptic boundary value ı problems,” Doklady Akademii Nauk SSSR, vol 185, pp 739–740, 1969 V A Il’pin and E I ... theory of Mawhin 12 Main Results We first recall some notation, and an abstract existence result Let Y , Z be real Banach spaces, let L : dom L ⊂ Y → Z be a linear operator which is Fredholm map of...
- 15
- 274
- 0
Báo cáo y học: " Clinical evaluation of autoantibodies to a novel PM/Scl peptide antigen" doc
Ngày tải lên :
09/08/2014, 06:22
... rheumatic diseases and to access all their clinical features Frank and colleagues analyzed sera from 216 patients with idiopathic inflammatory myopathies to assess putative associations between anti-SS -A/ Ro-52 ... anti-human IgG (Jackson ImmunoResearch Laboratories Inc., West Grove, PA, USA) was added to each well and incubated for an additional 30 The reactivity of the antigen-coated beads was determined on a ... scleroderma autoantibodies J Autoimmun 1999, 12:137-142 34 Yamanishi Y, Maeda H, Katayama S, Ishioka S, Yamakido M: Scleroderma-polymyositis overlap syndrome associated with antiKu antibody and rimmed...
- 10
- 487
- 0
Báo cáo y học: "APOBEC3G induces a hypermutation gradient: purifying selection at multiple steps during HIV-1 replication results in levels of G-to-A mutations that are high in DNA, intermediate in cellular viral RNA, and low in virion RNA" pps
Ngày tải lên :
13/08/2014, 05:21
... used to amplify the N-terminal region of Vif The C-terminal portion of Vif was amplified using the forward primer YRHHYmutF, 5'GGAAAGCTAAGGACTGGT TTGCTGCAGCTGCCGCTGAAAGTACTAATCCAAAAATA AG3', and ... using overlapping PCR to generate pHIV-YRHHY > A5 The forward primer VifF, 5'CAGGGAGATTCTAAAAG3', and the reverse primer YRHHYmutR, 5'CTTATTTTTGGATTAGTAC TTTCAGCGGCAGCTGCAGCAAACCAGTCCTTAGCTTTC C3', ... hypermutation across proviral DNA, cellular viral RNA (cRNA), and virion RNA (vRNA) observed in the vif of HIV-YRHHY > A5 (A and B) Schematic representation of a sample of proviral DNA sequences of...
- 15
- 320
- 0
The chart below shows the sleep patterns of people in five different occupations according to a Canadian study
Ngày tải lên :
04/10/2012, 10:02
... wake at a. m., but nap for two hours or so in the early afternoon Thus the influence on one's sleep pattern is worthy of consideration when choosing an occupation ...
- 2
- 1.4K
- 3
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
Ngày tải lên :
10/04/2013, 14:46
... central concern of applied linguistic As a matter of fact, C .A has had much to offer not only to practical language but also to translation theory, the description of particular language, language ... should be washed everyday Nguyễn Thị Nga K 1 1A 19 Graduation paper 2.2.5 Exclamatory adjective sentence An adjective as head of an adjective phrase or as its sole realization can be an exclamation: ... up to now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central...
- 44
- 1.8K
- 7
A RUSH OF BLOOD TO THE HEAD
Ngày tải lên :
17/10/2013, 18:20
... differently to ads replaying the September 11 attacks; the amygdalas of Democrats lit up far more noticeably than the amygdalas of Republicans Marco Iacobini, the lead researcher and an associate professor ... was about to take a seat at the neuroscience table and in the process, take on a brainy new look * * * IN 1975, WATERGATE was still scandalizing America Margaret Thatcher was elected the leader ... Mumbai The next day São Paolo Or Dublin, Tokyo, Edinburgh, San Francisco, Athens, Lima, Sri Lanka, or Shanghai But my hectic travel schedule is an advantage I can bring to a team that’s usually too...
- 21
- 386
- 0
A study of responding to dispraise in english and vietnamese
Ngày tải lên :
26/11/2013, 13:21
... non-verbal aspects, paralinguistic and extralinguistic factors master cross-cultural pragmatics as a whole A teacher may select any activity applicable to his/her classroom (See Appendix) To conclude, ... Goffman’s views on face and face-work, Brown & action threaten their negative face, whereas acts that appear as Levinson [6] offer a descriptive analysis of the strategies used by disapproving of ... Face-Threatening Acts 2.2.1.1 The Notion of Face (FTAs) FTAs, which may be targeted at either positive or negative Based on his observational research, Goffman [10] claims that face wants, will tend to...
- 13
- 714
- 2
Tài liệu Connecting to a Named Instance of SQL Server or Microsoft Data Engine (MSDE) docx
Ngày tải lên :
14/12/2013, 18:16
... Coordinator (DTC) and the Microsoft Search services are installed and used simultaneously by every installed instance of SQL Server Client tools such as Enterprise Manager and Query Analyzer are also ... also shared The System.Data.SqlClient class cannot automatically discover the port number of a named instance of SQL Server listening on a port other than the default 1433 To connect to a named ... string to specify the Data Source attribute for a named instance Each instance operates independently of the other instances installed on the same computer Each instance has its own set of system and...
- 3
- 406
- 0
Tài liệu How To Use the Six Laws of Persuasion during a Negotiation pptx
Ngày tải lên :
21/12/2013, 04:18
... negotiation with a variety of people This involves basic communication skills, such as active listening and attention to non-verbal cues, and a clear understanding of your goals, as well as the ... to make changes in your favor and, in a win-win situation, provide the other side with a fair deal This entails a process that can appeal to the intellect using logical and objective criteria, ... to get another one quickly, or at all, if you decide you want it later So you take the bait to buy a popular item that others won’t be able to get At least that’s what you think Law of Authority...
- 6
- 500
- 0
Tài liệu How To Use the Six Laws of Persuasion during a Negotiation docx
Ngày tải lên :
21/12/2013, 06:18
... negotiation with a variety of people This involves basic communication skills, such as active listening and attention to non-verbal cues, and a clear understanding of your goals, as well as the ... to make changes in your favor and, in a win-win situation, provide the other side with a fair deal This entails a process that can appeal to the intellect using logical and objective criteria, ... to get another one quickly, or at all, if you decide you want it later So you take the bait to buy a popular item that others won’t be able to get At least that’s what you think Law of Authority...
- 6
- 502
- 0
Developing a system of exercises to improve public speaking skill in interpreting for the 4th year students of english at vinh university
Ngày tải lên :
25/12/2013, 20:21
... appearance before going to stage As an overall trend, we can see that all of students at Vinh University have a good preparation of appearance before being a public speaker As can be seen clearly ... understand and know the way to improve their appearance when being a public speaker It will have a good effect to their speech later Through this part, we can realize that attitude and appearance are ... eyes contact in front of the mirror Step 2: Practice again the parts that student feels his voice and body language not naturally and suitably Step 3: Practice the total text again to make a perfect...
- 71
- 689
- 1
Developing a system of games to enhance short term memory for interpreter students at vinh university
Ngày tải lên :
25/12/2013, 20:21
... tools Each tool belongs to a particular game and it cannot be used with any other game For instance, a deck of playing cards can not be used to play in the Story Telling game Besides, some games ... define what games are Wittgenstein concluded that people apply the term game to a range of disparate human activities that bear to one another only what one might call family resemblances French ... presentation of an utterance in a source language” ( p.11) In professional parlance, interpreting can be understood as “the facilitating of communication from one language form into its equivalent,...
- 64
- 541
- 0
Use of an extension of the park's transformation to determine control laws applied to a non sinusoidal permanent magnet synchronous motor
Ngày tải lên :
03/01/2014, 19:50
... inkrval of electrical angle where Wra is near of its maximal value @', supplied with a negative voltage -E during the 120" interval of eltvtrical angle where @Im is near of its minimal value ... Park's transfonnation permits us to have a best knowledge of the non sinusoidal permanent magnet synchronous motor We are so able as well to analyse the classical control laws such as 120' voltage ... motor being not supply Park's transformation AAer this first transfoxmation, the Pa& transfomation allows us to work in the rotor's reference, through a rotation of an angle PO.Using the new variables...
- 6
- 438
- 2
Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt
Ngày tải lên :
14/02/2014, 19:20
... molecules and peptide atoms) and rj is the standard deviation of B factors The normalized B factors have a zero mean and unit variance All atoms that satisfy Bz ‡ are treated as outliers and discarded ... cargo The average atomic B factors for importin -a in the structure are ˚ ˚ 32.1 A2 for main-chain atoms, 35.7 A2 for side-chain ˚ overall (3244 atoms) For the pepatoms and 33.8 A tide, B factors ... Indicative of the tightness of the fit, there are a large number (30) of atom -to- atom van der Waals’ contacts between the Tyr205 side chain and importin -a (Table 2) The numbers of contacts are...
- 14
- 741
- 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
Ngày tải lên :
16/02/2014, 09:20
... values increase from G1P over PhyK to AppA by a factor of 2200 The conformational changes of AppA upon substrate binding facilitate a faster turnover of phytate and are in line with a higher specificity ... order to facilitate His-tag affinity purification The three distinct groups of HAPs are adapted to different habitats To support plant growth, bacteria not need to release phosphate as fast as the ... site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) Plasmid pET-1TK was used as template and Kleb(HtoA)fw (5¢-GCTTAGCCGCGCCGGCATTCG) and Kleb(HtoA)rv (5¢-CGAATGCCGGCGCGGCTAAGC) as primers...
- 13
- 766
- 0
Tài liệu Quantification of the Health Effects of Exposure to Air Pollution: Report of a WHO Working Group pdf
Ngày tải lên :
17/02/2014, 11:20
... life-table calculation of survival probabilities takes into account that deaths take place throughout a year Without precise dates of each death, the usual (“actuarial”) convention is that about half ... COMMITTEE OF THE ENVIRONMENTAL AND OCCUPATIONAL HEALTH ASSEMBLY OF THE AMERICAN THORATIC SOCIETY (ATS) Health effects of outdoor air pollution, Part American journal of respiratory and critical care ... COMMITTEE OF THE ENVIRONMENTAL AND OCCUPATIONAL HEALTH ASSEMBLY OF THE AMERICAN THORATIC SOCIETY (ATS) Health effects of outdoor air pollution, Part American journal of respiratory and critical care...
- 34
- 521
- 0