letter followed by all lowercase letters protein symbols are at upper case and not italicized genes coded by the mitochondrial genome have a prefix mt lowercase mt followed by a hyphen

Expression dynamics of the hepatic mitochondrial proteome of the sod2+  mouse in response to troglitazone administration

Expression dynamics of the hepatic mitochondrial proteome of the sod2+ mouse in response to troglitazone administration

Ngày tải lên : 12/09/2015, 11:08
... mass-spectrometry-based proteomics and (iii) and protein- chipbased arrays There are advantages and disadvantages to both platforms and they are listed in Table Due to the numerous facets of protein characteristics ... /RNS) in the pathogenesis of both rare and common human diseases (Droge, 2002) Mitochondrial diseases due to mutations in nDNA and mtDNA encoding for mitochondrial proteins are complex, and are confounded ... transmembrane potential; ACO1, cytosolic aconitase; ACO2, mitochondrial aconitase; AP-1, activator protein 1; CASP3, caspase-3; CATA, catalase; Cyt c; cytochrome c; GS, Glutamine synthase; GPX, glutathione...
  • 226
  • 1.8K
  • 0
phrasal verbs followed by the -ing form

phrasal verbs followed by the -ing form

Ngày tải lên : 01/11/2013, 15:20
... you go to various places and allow other people see you / was so embarrassed — I went around all day with my zipper open Are you going to go around all day wearing that stupid hat? go around p.v ... sure the phrasal verbs are in the correct tense You're going to spend the day on the sofa watching TV What are you going to all day? Lydia walked to various places in her new house making decorating ... What does the electricity do? Joe called and asked what was happening What did Joe ask? Bob goes to every office at work telling awful jokes What does Bob at work? Janice didn't go to bed all...
  • 16
  • 741
  • 0
Báo cáo y học: " Enteritis caused by Campylobacter jejuni followed by acute motor axonal neuropathy: a case report" pptx

Báo cáo y học: " Enteritis caused by Campylobacter jejuni followed by acute motor axonal neuropathy: a case report" pptx

Ngày tải lên : 11/08/2014, 12:20
... infection Ann Neurol 1995, 38:809-816 Yuki N, Yamada M, Koga M, Odaka M, Susuki K, Tagawa Y, Ueda S, Kasama T, Ohnishi A, Hayashi S, Takahashi H, Kamijo M, Hirata K: Animal model of axonal Guillain-Barre ... Belgrade, Serbia 4National Laboratory for Enteric Pathogens, National Microbiology Laboratory, The Canadian Science Centre for Human and Animal Health, 1015 Arlington Street, Winnipeg, Manitoba, ... Serbia, had nausea, fever, and had suffered watery diarrhea that lasted for one day The diarrhea was self-limiting and he was treated only with antipyretic drugs Ten days later, he felt muscle weakness...
  • 4
  • 351
  • 0
40185 prepositional verbs followed by the gerund

40185 prepositional verbs followed by the gerund

Ngày tải lên : 28/08/2016, 20:07
... what you wanted to Writers cannot rely their (share) _ a common context to interpret the other's casual, compact or cryptic speech If you usually keep your windows/doors open, then count ... If you usually keep your windows/doors open, then count (change) the air filter every month We all agree _ your (open) _ the discussion ...
  • 2
  • 317
  • 0
Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

Tài liệu Báo cáo khoa học: Perturbation of membranes by the amyloid b-peptide – a molecular dynamics study pptx

Ngày tải lên : 18/02/2014, 08:20
... using a window of ten data points designation In the case of simulation A1 , the area per lipid headgroup is largely constant at the outset of the ˚ simulation, fluctuating around a value of 62 A2 ... the bilayer normal, and the angle brackets denote that the values are averaged over all equivalent atoms, and over time We observed that the lipids nearest melittin experience a greater degree of ... represent an average of the plateau region for each leaflet of the bilayer From these data, it can be seen that, overall, the )SCD values in the top leaflet of the Ab40-DPPC systems are lower than those...
  • 16
  • 475
  • 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Ngày tải lên : 21/02/2014, 01:21
... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s instructions (mutagenic ... primers ECM-5¢ d(5¢-AGCTATACCCTGCCATCCCTG) and ECM-3¢ d(5¢-TTATTTTTTCGCCGCAAAACGTG) and E coli genomic DNA as template PCR was carried out using Amplitaq enzyme according to the manufacturer’s instructions...
  • 12
  • 740
  • 0
Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Báo cáo khoa học: Glutamic acid residues in the C-terminal extension of small heat shock protein 25 are critical for structural and functional integrity pptx

Ngày tải lên : 07/03/2014, 04:20
... CCAAATT-3¢ and 5¢-AATTTGGGCGCGGGCCGCGA AAGTAACCGGAAT-3¢ for E19 0A, 5¢-CAAATTGGGGG CCCAGCAGCTGGGAAGTCTGAA-3¢ and 5¢-TTCAGA CTTCCCAGCTGCTGGGCCCCCAATTTG-3¢ for E19 9A, and 5¢-GAAGCTGGGAAGTCTGCACAGTCTGGAGCC ... resulting in the aggregation and precipitation of the B chain Reduction stress assays are advantageous over thermal stress assays as they can be performed at physiological temperatures, i.e 37 °C The ... calibrated with blue dextran (2 MDa), thyroglobulin (669 kDa), apoferritin (443 kDa) and catalase (250 kDa) Standard deviations are given as the oligomeric range at half peak height [69] Thermostability...
  • 14
  • 417
  • 0
Báo cáo khoa học: Phosphorylation of the Saccharomyces cerevisiae Grx4p glutaredoxin by the Bud32p kinase unveils a novel signaling pathway involving Sch9p, a yeast member of the Akt / PKB subfamily pot

Báo cáo khoa học: Phosphorylation of the Saccharomyces cerevisiae Grx4p glutaredoxin by the Bud32p kinase unveils a novel signaling pathway involving Sch9p, a yeast member of the Akt / PKB subfamily pot

Ngày tải lên : 07/03/2014, 04:20
... (Mj1130p) indicate that the Bud32p C-terminal tail is located far from the catalytic site, suggesting that its alteration should not be detrimental to the overall structure Finally, our data are consistent ... substrate casein, and observed that both forms of Bud32p, phosphorylated or not, had similar catalytic properties, as they were able to phosphorylate casein (data not shown) These results may therefore ... respectively Asp161 and Lys52, two amino acids that are essential for the catalytic activity of the recombinant protein [2] The two bud32 mutants are characterized by a slow growth phenotype that is,...
  • 15
  • 414
  • 0
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

Ngày tải lên : 16/03/2014, 05:20
... primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢) For PCR, the reaction mix consisted of · Taq buffer containing 1.5 mm ... hepatopancreas; Mu, muscle; Ov, ovary); the bar indicates the SE (B) The expression pattern of MeMIH-B (N > 20) at different gonad maturation stages of the eyestalk (open bar) and thoracic ganglia ... from a local seafood market They were acclimated in the laboratory at 25–28 °C in an indoor aquarium for days before rMeMIH-B or dsRNA injection The GSI was calculated as the percentage of ovary...
  • 11
  • 546
  • 0
Báo cáo khoa học: Variants of b2-microglobulin cleaved at lysine-58 retain the main conformational features of the native protein but are more conformationally heterogeneous and unstable at physiological temperature potx

Báo cáo khoa học: Variants of b2-microglobulin cleaved at lysine-58 retain the main conformational features of the native protein but are more conformationally heterogeneous and unstable at physiological temperature potx

Ngày tải lên : 23/03/2014, 11:20
... that this compact, seven b-stranded protein is conformationally unstable after cleavages and truncations, and that even intact b2m may, to a minor extent, adopt an alternative conformation at ... demonstrated by size exclusion chromatography of dK58-b2m incubated at 310 K [10] The NMR data clearly indicate that the overall folding pattern of the cleaved b2m variants is very similar to that ... cooling fluid maintained at 278 K Samples also contained 0.2 mgÆmL)1 of a marker peptide Shown are the summed peak areas P (total area of f + s peaks) divided by the marker peak area M at different...
  • 14
  • 358
  • 0
Báo cáo khoa học: The phosphatidylethanolamine level of yeast mitochondria is affected by the mitochondrial components Oxa1p and Yme1p ppt

Báo cáo khoa học: The phosphatidylethanolamine level of yeast mitochondria is affected by the mitochondrial components Oxa1p and Yme1p ppt

Ngày tải lên : 30/03/2014, 04:20
... CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC TCTAATACGACTCACTATAGGGAGAATGTCAATTATGCCAGTTAAG CTTTACATATGATTGCTTTCATTTTAAATCATTCTTTCC AGAACTGCGGTGCTATGGAATAGA TTTGGCACGATCCACAATCTC an overnight culture and cells ... GTTCACGTACAAGCGGAGCCACAGAATAACCTCCCCGACGCGGATCCCCGGGTTAATTAA GTTTTATATTTTTATATTTACAGAGAGATATAGAGCCTTTATGAATTCGAGCTCGTTTAAAC GCCAGTTAAGAACGCCTTGGCGCAAGGGAGGACGCTCCTCCGGATCCCCGGGTTAATTAA CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC ... functional Oxa1p is missing the membrane subunits of these complexes cannot be assembled and are cleaved by the intermembrane space (i)-AAA protease Yme1p and ⁄ or by the matrix (m)AAA protease Afg3p...
  • 11
  • 354
  • 0
Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

Ngày tải lên : 22/06/2014, 22:20
... reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates at relatively low temperatures Indeed, the heating of the reaction mixture without amines at elevated temperature did not result ... temperature The shape and size tunability of SnS NCs can be achieved by controlling the reaction temperature and time, and the nature of stabilizing ligands HRTEM investigation and XRD analysis ... solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band gap for SnS NCs compared with the bulk material can be explained by quantum confinement...
  • 5
  • 365
  • 0
Báo cáo hóa học: " Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" ppt

Báo cáo hóa học: " Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" ppt

Ngày tải lên : 22/06/2014, 22:20
... reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates at relatively low temperatures Indeed, the heating of the reaction mixture without amines at elevated temperature did not result ... temperature The shape and size tunability of SnS NCs can be achieved by controlling the reaction temperature and time, and the nature of stabilizing ligands HRTEM investigation and XRD analysis ... solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band gap for SnS NCs compared with the bulk material can be explained by quantum confinement...
  • 5
  • 276
  • 0
Báo cáo y học: "Diabetic ketoacidosis complicated by the use of ecstasy: a case report" ppsx

Báo cáo y học: "Diabetic ketoacidosis complicated by the use of ecstasy: a case report" ppsx

Ngày tải lên : 11/08/2014, 03:21
... reveal bacteria; arterial blood gas measurement revealed clinically important metabolic acidosis (Table 1); and lactate was in the normal reference range The patient received immediate intravenous ... reviewed the literature and wrote the first draft of the report MPRG was the chief clinician, edited the first draft of the manuscript and assisted in the literature review All authors read and approved ... rate and arterial blood pressure); exacerbation of anxiety; and activation Page of of the hypothalamic-pituitary-adrenal axis The most frequently reported side effects are arrhythmias, hyperthermia,...
  • 3
  • 399
  • 0
Báo cáo y học: "Diabetic ketoacidosis complicated by the use of ecstasy: a case report." docx

Báo cáo y học: "Diabetic ketoacidosis complicated by the use of ecstasy: a case report." docx

Ngày tải lên : 11/08/2014, 07:20
... reveal bacteria; arterial blood gas measurement revealed clinically important metabolic acidosis (Table 1); and lactate was in the normal reference range The patient received immediate intravenous ... reviewed the literature and wrote the first draft of the report MPRG was the chief clinician, edited the first draft of the manuscript and assisted in the literature review All authors read and approved ... rate and arterial blood pressure); exacerbation of anxiety; and activation Page of of the hypothalamic-pituitary-adrenal axis The most frequently reported side effects are arrhythmias, hyperthermia,...
  • 3
  • 327
  • 0
Báo cáo y học: "Inhibition of NFκB by the natural product Withaferin A in cellular models of Cystic Fibrosis inflammation" pps

Báo cáo y học: "Inhibition of NFκB by the natural product Withaferin A in cellular models of Cystic Fibrosis inflammation" pps

Ngày tải lên : 11/08/2014, 08:22
... infection and these cells release proteases and other agents that cause structural damage to the airways Anti-inflammatory agents are used to manage lung inflammation in CF, but have adverse effects ... concentrations of WFA followed by stimulation with 10% PAF (WFA, 0.3, and μM) Data from luciferase reporter assays are reported as averaged arbitrary mean luminescence + standard deviation from samples ... complementary and alternative approaches to supplement conventional therapies [23] We are intrigued by this finding, as there are many promising anti-inflammatory and anti-bacterial ethnopharmacological...
  • 5
  • 306
  • 0
A study on the structure of the speech “ I have a dream” by Martin Luther King A systemic functional grammar analysis

A study on the structure of the speech “ I have a dream” by Martin Luther King A systemic functional grammar analysis

Ngày tải lên : 10/08/2015, 19:48
... Functionalists, on the other hand, hold the belief that “Grammar should be seen as facilitating communication in all modes, not as an isolated area of study” (G Lock, 1996) As having the experience ... language teaching and learning becomes Hence, I decided to conduct a study on the structure and meaning of the speech “I have a dream” by Martin Luther King - a systemic functional grammar analysis ... analysis based on Halliday’s functional grammar as the theoretical framework 1.2 Aims of the study In carrying out the research, the writer aims to:  Illustrate the key concepts in FG  Analyze the...
  • 4
  • 676
  • 5
Tài liệu Protein Data Bank Contents Guide: Atomic Coordinate Entry Format Description Version 3.20 Document Published by the wwPDB ppt

Tài liệu Protein Data Bank Contents Guide: Atomic Coordinate Entry Format Description Version 3.20 Document Published by the wwPDB ppt

Ngày tải lên : 16/02/2014, 10:20
... Optional Mandatory if a non-standard group other than water appears in the coordinates HETNAM Optional Mandatory if a non-standard group other than water appears in the coordinates HETSYN Optional FORMUL ... HETATM Optional Mandatory if non-standard group exists Mandatory if a non-standard group or water appears in the coordinates PDB File Format v 3.2 Page 12 ENDMDL Optional Mandatory if MODEL appears ... that have been replaced by a newer entry TITLE Mandatory SPLIT Optional Mandatory when large macromolecular complexes are split into multiple PDB entries CAVEAT Optional Mandatory when there are...
  • 205
  • 387
  • 0
Tài liệu Báo cáo khoa học: Mitochondrial chaperone tumour necrosis factor receptor-associated protein 1 protects cardiomyocytes from hypoxic injury by regulating mitochondrial permeability transition pore opening docx

Tài liệu Báo cáo khoa học: Mitochondrial chaperone tumour necrosis factor receptor-associated protein 1 protects cardiomyocytes from hypoxic injury by regulating mitochondrial permeability transition pore opening docx

Ngày tải lên : 16/02/2014, 14:20
... of the siRNA against rat TRAP1 was 5¢-CAACAGAGATTGATCAA AT- 3¢ A negative control adenovirus vector containing nonspecific siRNA was constructed in the same way (nonspecific vector, 5¢-TTCTCCGAACGTGTCACGT-3¢) ... potential and pH gradient dissipate, preventing ATP generation by oxidative phosphorylation Ultimately, these changes lead to cell death through the activation of phospholipases, nucleases and proteases ... were then scraped, and the resulting lysate was ultrasonicated and centrifuged at 12 000 g for 20 at °C The supernatant was subjected to western blot analysis Western blot analysis B Fig CsA prevented...
  • 10
  • 507
  • 0
Tài liệu Báo cáo khoa học: Regulators of G-protein signalling are modulated by bacterial lipopeptides and lipopolysaccharide pptx

Tài liệu Báo cáo khoa học: Regulators of G-protein signalling are modulated by bacterial lipopeptides and lipopolysaccharide pptx

Ngày tải lên : 18/02/2014, 13:20
... that the inflammatory and the adjuvant activities of TLR-ligands are at least partially mediated through modulation of RGS1 and RGS2 The molecular mechanisms, leading to this modulation and the ... unclear Biochemical studies have shown that RGS proteins have GTPase activity and act as a GTPase activating protein (GAP) As a result, RGS proteins enhance GTP hydrolysis rates for purified Gai and ... statistically analysed by s-score test Total RNA was isolated using Absolutely RNA Miniprep kit (Stratagene, Amsterdam, the Netherlands), including DNase treatment, in accordance with the manufacture’s...
  • 11
  • 569
  • 0