lepidopterans as model mini hosts for human pathogens and as a resource for peptide antibiotics
Báo cáo y học: " Chinese medicines as a resource for liver fibrosis treatment" ppsx
... Zingiberis, Ramulus Cinnmomi, Radix Aconiti Lateralis preparata, Radix Astragali, Radix Bupleuri, Fructus Aurantii, Rhizoma Atractylodis macrocephalae, Radix Glycyrrhizae Radix Salvia miltiorrhizae, Cordyceps ... GOT and GPT in rats with CCl4induced liver damage [89,98] Most of the Chinese medicines in Tables and reduce serum enzymes, i.e aspartate transaminase (AST) and alanine transaminase (ALT) A study ... Glycyrrhizae, Pericarpium citri reticulatae, Rhizoma Atractylodis macrocephalae, Radix Ginseng, Radix Paeoniae alba, Radix Rehmanniae, Fructus Schisandrae chinensis, Poria, Cortex et Radix Polygalae Radix...
- 11
- 428
- 0
Báo cáo y học: "A mouse plasma peptide atlas as a resource for disease proteomics" ppt
... of a pool of plasma from a mouse model of cancer and its matched wild-type control Materials and methods Sample preparation and mass spectrometry analysis The data for the mouse plasma PeptideAtlas ... (IPLENLQIIR amino acids 99-108, lab 34), was also identified in the PeptideAtlas analysis of the Human Proteome Organization (HUPO) human plasma samples as the mouse and the human share the same sequence ... was appended to the sequence database The formatted peak list files from each dataset were searched against the target database using X!Tandem; peptides identified with an X!Tandem expect value...
- 10
- 422
- 0
Tài liệu Managing Your Suppliers as a Resource Introduction Several years ago, I visited Camco, GE''''s doc
... Innovative supplier management, using your suppliers as a resource, allows both companies to move past the traditional adversarial relationship toward a partnership with deep mutual value creation ... (1) a diagram of the information and product flow at each channel stage, including handling, storage, moving, processing, etc.; (2) a quantitative analysis, or representative model, of product accumulation ... all too many companies In many companies, the cost of materials and components exceeds the internal value-added through manufacturing or assembly Yet the fundamental nature of staffing and process...
- 8
- 363
- 0
Sustaining Business and Peace: A Resource Pack on Corporate Responsibility for Small and Medium Enterprises docx
... responsibility: Accountability and transparency of financial dealings including auditing and reporting accurately Adhering to standards: Beyond basic compliance, regulations and industry standards to ... Analyse context Analyse risks and impacts Gather information on stakeholders and context, and analyse in relation to your company Analyse societal risks, and the impacts your company operations ... Development Assistance: Practical Training Report for GTZ-Nepal, Kathmandu International Alert Notes: 19 20 Sustaining Business and Peace A Resource Pack on Corporate Responsibility for Small and Medium...
- 120
- 841
- 0
UP AND AWAY: A resource book for English language support in primary schools pptx
... cultures/nationalities • The Christmas party and other festival days/celebrations • Night courses for all parents, such as IT, cookery, yoga, art and craft, languages, etc • Graduation day for 6th class ... language support (continued) A1 BREAKTHROUGH A2 WAYSTAGE • Can greet, say ‘Please’ and ‘Thank you’, and ask for directions to another place in the school • Can ask for attention in class • Can ... and on the way to school • Can recognize and understand basic words on labels or posters in the classroom • Can identify basic words and phrases in a new piece of text • Can read and understand...
- 248
- 776
- 0
báo cáo hóa học: " Sense of coherence as a resource in relation to health-related quality of life among mentally intact nursing home residents – a questionnaire study" pot
... martial status, educational level), the variable length of stay was not statistically significant for any subscale Adjusted R2 was unchanged for mental health and vitality and slightly higher for physical ... general linear model procedure of SPSS for Windows (version 14.0) We coded sex, age group, marital status and education as categorical variables and used SOC and comorbidity as continuous covariates ... (partial eta) [43] in a general linear model This partial correlation coefficient estimates the association between SOC and SF-36 after allowing for the associations with the demographic variables...
- 9
- 844
- 0
Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf
... which maintains the ability of proliferation and invasion Choriocarcinoma is a malignant neoplasm that represents the early trophoblast of the attachment phase or as later invasive stage [46–48] ... sum of cell-associated and degraded 125I-labeled HDL3 reflects holoparticle association For the [3H]CE-HDL3- Total RNA was isolated from choriocarcinoma and human liver tissues (used as a positive ... reproductive and cardiovascular pathophysiology Proc Natl Acad Sci USA 96, 9322–9327 62 Imachi, H., Murao, K., Sayo, Y., Hosokawa, H., Sato, M., Niimi, M., Kobayashi, S., Miyauchi, A. , Ishida, T & Takahara,...
- 12
- 470
- 0
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx
... a CD34+ hESC-derived starting population has been considered as a potential AIDS therapy, and as a way to alleviate secondary effects produced by anti-retroviral drugs [16] Various studies have ... from Leukemia and Lymphoma UK, Fanconi New advances in human hematopoiesis from human ESCs Hope UK and the Fanconi Anemia Research Fund USA, and funds for research in the field of regenerative medicine ... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway...
- 12
- 550
- 0
Human embryonic stem cells as a cellular model for osteogenesis in implant testing and drug discovery
... OCT4 F: CGRGAAGCTGGAGGAGAAGGAGAAGCTG 55 oC R: AAGGGCCGCAGCTTACACATGTTC NANOG F: GGCAAACAACCCACTTCTGC 55 oC R: TGTTCCAGGCCTGATTGTTC β-ACTIN F: ACAGAGCCTCGCCTTTGCC 58 oC R: ACATGCCGGAGCCGTTGTC 2.1.5 ... using hESCs as a model In this study, taking hESCs differentiation towards osteogenic lineage as an example, we proposed a set of functional assays as a standard of hESCs as a model for drug discovery ... testing, there is lack of universal standard in measuring the variations between batch to batch As a potential cell model for drug disvoery, hESCs has been used as a source in a few labs, and most of...
- 117
- 385
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Health Center, 1650 Cedar Avenue, Montreal, H3G 1A4 , Qc, Canada Full list of author information is available at the end of the article thymic and peripheral CD4+ T cells in humans and mice, and ... Pediatr Res 2000, 48:6-11 19 Bernasconi A, Marino R, Ribas A, Rossi J, Ciaccio M, Oleastro M, Ornani A, Paz R, Rivarola MA, Zelazko M, Belgorosky A: Characterization of immunodeficiency in a patient...
- 12
- 573
- 0
Báo cáo sinh học: "Glutamate carboxypeptidase activity in human skin biopsies as a pharmacodynamic marker for clinical studies" docx
... activity assay provides a simple and direct measurement of GCP activity from tissue samples easily assessable in human subjects Abbreviations GCP: glutamate carboxypeptidase; NAAG: N-acetyl-aspartyl-glutamate; ... as source of GCP in the activity assay Rat paw pads and sciatic nerve isolated from vehicle and 2-PMPA treated animals were sonicated for in ice The mixture was centrifuged for at 16000 × g and ... detected (Figure 3A) and the chromatographic peaks of 2-PMPA and internal standard (Figure 3B) allowed for quantitation of material in the Rojas et al Journal of Translational Medicine 2011,...
- 8
- 406
- 0
báo cáo hóa học:" Glutamate carboxypeptidase activity in human skin biopsies as a pharmacodynamic marker for clinical studies" doc
... activity assay provides a simple and direct measurement of GCP activity from tissue samples easily assessable in human subjects Abbreviations GCP: glutamate carboxypeptidase; NAAG: N-acetyl-aspartyl-glutamate; ... as source of GCP in the activity assay Rat paw pads and sciatic nerve isolated from vehicle and 2-PMPA treated animals were sonicated for in ice The mixture was centrifuged for at 16000 × g and ... detected (Figure 3A) and the chromatographic peaks of 2-PMPA and internal standard (Figure 3B) allowed for quantitation of material in the Rojas et al Journal of Translational Medicine 2011,...
- 8
- 304
- 0
báo cáo hóa học:" Force-feedback interaction with a neural oscillator model: for shared human-robot control of a virtual percussion instrument" doc
... Cadoz (claude.cadoz@imag.fr) and Nicolas Castagn´ (nicoe las.castagne@imag.fr) Association pour la Cr´ation et la Recherche sur les Outils d’Expression e (ACROE) and ICA Laboratory Grenoble Institute ... employ a computable mechanical analog model of a neural oscillator for implementing force–feedback interaction A linear-only version of the mechanical analog model was proposed earlier by Claude Cadoz ... Digital Audio Effects (DAFx-10) Graz (Austria, 2010) 36 T Dang, T Annaswamy, M Srinivasan, Development and evaluation of an epidural injection simulator with force feedback for medical training,...
- 58
- 327
- 0
Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot
... self-tolerance; deficit of a T cell subset as a possible cause of autoimmune disease J Exp Med 1985, 161:72-87 Kuniyasu Y, Takahashi T, Itoh M, Shimizu J, Toda G, Sakaguchi S: Naturally anergic and ... allogeneic organ transplants Acknowledgements This research was supported in part by National Institutes of Health grant AI 41768, The Nora Eccles Treadwell Foundation, and the Arthritis Foundation-Southern ... Sakaguchi S, Fukuma K, Kuribayashi K, Masuda T: Organ-specific autoimmune diseases induced in mice by elimination of T cell subset I Evidence for the active participation of T cells in natural...
- 6
- 408
- 0
Báo cáo y học: "Decreased metalloproteinase production as a response to mechanical pressure in human cartilage: a mechanism for homeostatic regulatio" pps
... Figure Analysis of aggrecan and type II collagen in OF and OA cartilage Ratio II collagen in OF and OA cartilage of aggrecan to type II collagen in the cartilage matrix of OA and OF femoral heads and ... proteoglycan extraction and was quantified by Bradford method Separated maximum (SP) and minimum (IP) mechanical load areas were obtained from each femoral head The horizontal bar indicates the median, ... comparison between areas (SP and IP) Aggrecan and type II collagen were quantified using ELISA after cartilage proteoglycan extraction Aggrecan was assessed from supernatant soluble fraction, and...
- 11
- 520
- 0
Báo cáo y học: "Sequencing the genome of the Burmese python (Python molurus bivittatus) as a model for studying extreme adaptations in snakes" ppsx
... the families Viperidae (for example, rattlesnakes, and adders) and Elapidae (for example, coral snakes, cobras, and mambas) In addition to these lineages that contain commonly used model research ... University of California Santa Cruz [32] and NCBI [33] genome browsers for public queries as soon as it is available and passes contamination analyses, and relevant announcements and links will ... collected, and an effort to make available sets of sequences for use as molecular markers for snakes (for example, microsatellite primers and orthologous loci for use in phylogenetics and other applications)...
- 8
- 410
- 0
Báo cáo y học: "valuation of a recombinant human gelatin as a substitute for a hydrolyzed porcine gelatin in a refrigerator-stable Oka/Merck live varicella vaccine." pps
... refrigerator-stable varicella vaccine formulation contains stabilizers such as sucrose, hydrolyzed porcine gelatin, phosphate, glutamate, and urea, as well as a live attenuated varicella virus (Oka/ Merck) and ... sequence-based gelatin fragment (8.5 kDa) that can be used as a substitute for animal-derived material and has been shown to function as an effective alternative stabilizing ingredient in a live attenuated ... with a standard error ± 0.03) and the recombinant human gelatin-containing (0.70 log10 PFU with a standard error ± 0.06) varicella vaccines After lyophilization, the vials with varicella vaccine...
- 6
- 289
- 0
Báo cáo y học: "Synthetic rabbit-human antibody conjugate as a control in immunoassays for immunoglobulin M specific to hepatitis E virus" ppsx
... Hackett J Jr, Hoff-Velk J, Golden A, Brashear J, Robinson J, Rapp M, Klass M, Ostrow DH, Mandecki W: Recombinant mouse -human chimeric antibodies as calibrators in immunoassays that measure antibodies ... HT, Lu Q: An outbreak of enterically transmitted non -A, non-E viral hepatitis J Viral Hepat 1999, 6:59-64 Tanaka T, Takahashi M, Kusano E, Okamoto H: Development and evaluation of an efficient ... anti-HEV IgG was conjugated with human IgM and used as the positive control in immunoassays for the detection of anti-HEV IgM The synthetic rabbit -human antibody conjugate offers several advantages...
- 5
- 311
- 0
Báo cáo y học: "Use of a multi-virus array for the study of human viral and retroviral pathogens: gene expression studies and ChIP-chip analysis" pot
... normalized using a human genomic β-actin calibration curve Absolute viral and β-actin DNA copy number was assessed and final viral DNA load per 106 cells was calculated by the following formula: ... separated through a 1% agarose gel and analyzed for the presence and correct size of each amplicon Each product was graded as strong, acceptable, questionable, smear, misprimed, or failed and ... Mukai T, Nakano K, Kagawa M, Chen J, Mori Y, Sunagawa T, Kawanishi K, Sashihara J, Hata A, Zou P, Kosuge H, Yamanishi K: Comparison of the complete DNA sequences of human herpesvirus variants A...
- 15
- 376
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25