legislation particularly changes in tax rates and the company s economic performance shall give rise to a variation in deferred tax assets and liabilities
... CSR is viewed and then, a comprehensive set of policies, practices, and programs is integrated into business operations, supply chains, and decision-making processes throughout thecompanyand ... social and ethical issues It was emerged as an inclusive and global approach to appreciate corporate social responsibility, responsiveness andthe entire numbers of socially beneficial business activities ... calculates ratings based on a combination source of surveys: financial statements, articales on companies inthe popular press, academic journals and government reports The final rating for each...
... “Strategic management is an ongoing process that evaluates and controls the business andthe industries in which thecompany is involved; assesses its competitors and sets goals and strategies ... market and almost are not familiar with the advantage of using strategies in their business The business activities of one Securities Company have three main parts consisting of brokerage, investment ... 50% of total market share in Vietnam stock market andthe less is belong to more than ninety smaller ones As a result, five biggest securities such as SSI, ACBS, VCBS, TSC and HSC have rather high...
... activities As the result, balancing the interests of stakeholders is set as a content key in business administration The managers of the enterprises must find the way to balance the interests of stakeholders ... loyalty and creativity.” Finally, CSR is a certain role in addressing the risk, the crisis of the business Businesses can use CSR as an end in itself to solve the crisis or risk thecompany Because ... 34 awareness and attitude of CSR activities The questionnaires given to managers showed the practical applications of CSR inthecompany as well as the manager s attitudes The questionnaire was...
... suggests that investors are more optimistic about the market value of a firm s assets, its intangible assets, and its managers‟ abilities Financial managers and analysts often talk about the quality ... forecasting (to use as the basis of business decisions).5 We will write: Yt = response of interest at time t Standard analysis of business time series involves smoothing trend assessment, assessment ... total-debt -to- total -assets ratio is computed by dividing the total debt or total liabilities of the business by its total assets This ratio shows the portion of the total assets financed by all creditors and...
... of assets that rely on credit (housing and autos, for example) are declining As the economy s sluggish performance persists, profits collapse, jobs disappear, and wages remain stagnant Industrial ... my analysis, I assume that U .S private domestic holders can probably increase their holdings moderately now that households are consuming less and saving more, and financial institutions have ... spends more than it collects in taxes The increase in government debt allows the increase in household and business spending, which leads tothe growth in personal and international debt It is the...
... Inland Sea The location of the research area andthe distribution of the citrus groves in Matsuyama region are shown in Fig Matsuyama is situated in Shikoku Island inthe southwestern part of Japan ... areas As the area around the Seto Inland Sea has a small amount of rainfall with a comparatively warm climate, the cultivation of citrus fruits is popular The ratio of the citrus groves tothe total ... respectively Stream water samples were collected at the middle parts of the grove from points Sampling points St.1 and St.2 are inthe same stream, and sampling point St.3 is inthe other stream...
... analysis of the euro area includes both deposit and lending rates Among deposit rates, we analyse the overnight deposit rate andthe savings deposit rate As for lending rates, we analyse therates ... Belgian retail interest rates analysed include both lending rates (interest rates on short- and long-term loans to non-financial corporations, and loans for house purchase) and deposit rates (savings ... countries (Ireland and Spain) again began to spike, whereas the French and German markets were mostly spared The ECB s purchase programme was justified inthe early stages of the crisis by intrinsic...
... on these four ratios: • Gross losses on earning assetsto earning assets • Real estate loans to earning assets • Securities other than those of the U .S government to earning assets • Interest ... received to earning assetsThe presumption was and still is—that the higher these ratios, the lower the quality of the bank 'sassetsand so the higher its risk Gross losses on earning assets are considered ... demand deposits to total demand deposits His bank risk variables included four measures of gross earnings, two measures of investments as percentages of total assets, and six measures of losses...
... 310 nmol ADP and 10 mM succinate or mM glutamate and mM malate (state 3) and when all the ADP has been consumed (state or resting state) Oxygen-consumption rates are expressed as ng atoms of oxygen ... BSA, and this solution was used as the standard ina competitive ELISA Isolation of mitochondria A 10% tissue homogenate was prepared in an ice-cold medium containing 220 mM mannitol, 70 mM sucrose, ... aging, in parallel with a large decrease in Lon protease activity Materials and methods Animals Experiments were performed on male Wistar rats (WAG/ Rij) born and raised inthe animal care facilities...
... Rates Since 1945 Appendix Data and Supplemental Analysis For the analysis, data was gathered from a variety of publicly available sources: • Top marginal taxratesand top capital gains tax rates: ... important to investment For risk-averse investors, the capital gains tax could act as insurance for risky investments by reducing the losses as well as the gains—it decreases the variability of investment ... top marginal tax rate is denoted by MTR andthe top capital gains taxrates is denoted by KTR The top tax rate variables are entered into the regressions as the after -tax or netof -tax shares, which...
... with ADP and succinate as described inthe Materials and methods section Hexokinase and phosphofructokinase activities were measured inthe cytosolic fractions Isocitrate dehydrogenase and NADH:ubiqinone ... oxidoreductase (Complex I) As shown in Table 2, there was a marked difference inthe total cell ATP synthesis as well as mitochondrial respiration-coupled ATP synthesis in macrophages and PC12 cells The ... NADH:ubiqinone oxidoreductase (complex I) activities were measured in isolated mitochondria by standard methods as indicated inthe Materials and methods section Values are given as means ± SD calculated...
... measured quantitative changesin both peptide and transcript abundance in eyestalk neurosecretory tissues during intermoult and premoult Materials and methods Animals and peptides Carcinus maenas were ... (data not shown) indicate that MIH is episodically and, toa certain extent, stochastically released in intermoult animals, and has a short half-life of between and 10 As peaks in circulating MIH ... CHH-SR MIH-SF MIH-SR AK-SF AK-SR GCCATGCTAGCAATCATCACCGTAG GTTGAGATCTGTTGTTTACTTCTTC GAGTTATCAACGACGAGTGTCC GAGACGACAAGGCTCAGTCC AAAGGTTTCCTCCACCCTGT ACTTCCTCGAGCTTGTCACG GACTTGGAGCACGTGTGT TATTGGTCAAACTCGTCCAT...
... referred toin paragraph 39(c) result from: (a) translating income and expenses at the exchange rates at the dates of the transactions andassetsandliabilities at the closing rate Such exchange ... operation and any fair value adjustments tothe carrying amounts of assetsandliabilities arising on the acquisition of that foreign operation shall be treated as assetsandliabilities of the foreign ... This Standard also permits a stand-alone entity preparing financial statements or an entity preparing separate financial statements in accordance with IAS 27 Consolidated and Separate Financial...
... suggestions We also thank Konstantin (Kosta) Kosenko for sharing with us his data on pyramidal groups in Israel, and Yevgeni Ostrovsky and Gill Segal for outstanding research assistance Financial support ... preliminary, and group affiliation is not always as stable and as clearly defined as in some other countries such as Korea (which 17 has served as a testing ground for many theories on business groups and ... Nunes, Helen Ding and Anil Markandya: TheEconomic Valuation of Marine Ecosystems Andreas Madestam: Informal Finance: A Theory of Moneylenders Efthymia Kyriakopoulou and Anastasios Xepapadeas:...
... 47 Hayashi, H., Mizugushi, H., Miyahara, I., Nakajima, Y., Hirotsu, K & Kagamiyama, H (2003) Conformational change in aspartate aminotransferase on substrate binding induces strain inthe catalytic ... conformational states to thermal denaturation Results obtained with semidenaturing electrophoresis seem to indicate that histidine analogs can induce changesinthe enzyme to conformational states ... between an enzyme and its substrate induce conformational changes at the active site In most cases, these conformational changes are only local and relatively small However, for some enzymes these changes...
... stipulated for both fishing association and self-management team Instead of this, it is only member s responsibilities and duties in relation tothe using lagoon s areas As a result, most of resource ... experiences on aquaculture, help each other when having disasters, diseases, and financial difficulty, and (iii) resolving conflicts in fishing grounds and about resources among individuals and/ or household ... resources and its water surface area are substantially important However, the management of use rights and access to resources in practice seem to create conflicts among the users either in groups,...
... began to shift towards establishing essential areas, industrial zones, export processing zones and areas specialized in industrial plants, etc Inflation was kept under control and driven back: ... of Science, Economics and Business 26, No 5E (2010) 11-23 spending anda liquidation of domestic saving Whilst the state s earlier attempts to sustain central planning and its institutions succeeded ... fullscale conversion to capitalism, but rather a cautious acceptance of the market as a means for achieving economic growth, improving people s living standard and, thereby, maintaining and strengthening...
... disappointing of all, figure also shows that retail bank lending declined and continues to decline so far in 2009 Insofar as U .S commercial banks did slightly increase their net assets as the ... importers and households increase Surprisingly, retail bank credit inthe both the U .S and Europe is still declining The sharp weakening of the dollar against the euro and other important currencies ... the support remains controversial One group of protagonists sees unsustainable fiscal deficits andthe extraordinary overhang of excess bank reserves as a portent of a monetary explosion and...
... (five examinations in total) covering areas such as Code of Ethical Conduct, International Standards of Auditing (ISA), and Fiscal Legislationin Albania They also have to attend longer seasons of ... accounting and auditing Nowadays, after 20 years of full scale reforms Albania possesses adequate (regulatory and supervisory) instruments to guarantee qualitative accounting, auditing and financial ... such as accounting, financial reporting and financial statement analysis andthe other the civil law, labor act andcompany act of Albania) On the other hand, the procedures and criteria to be...
... Our structures of PRV8 2A and PRL90M showed opposite changesinthe main chain atoms of residues 81–82, and PRL90M also had changesinthe conformation of the catalytic aspartates, probably associated ... longer distances of 2.9 and 3.2 A It is possible that the asymmetrical interaction of indinavir O2 with the catalytic aspartates is associated with the short van der Waals interaction of the Met90/90¢ ... of Ala82 within reasonable van ˚ der Waals distance of indinavir (4.1 A) , resulting ina loss of only one contact compared to PR In contrast, studies of an inactive protease containing the mutations...