learning from labeled and unlabeled data on a directed graph
Báo cáo khoa học: "Boosting Statistical Word Alignment Using Labeled and Unlabeled Data" ppt
Ngày tải lên :
08/03/2014, 02:21
...
domain: Labeled Data (LD) and Unlabeled Data
(UD). The Chinese sentences in the data are
automatically segmented into words. The statis-
tics for the data is shown in Table 1. The labeled
data ... labeled data and large amounts of
unlabeled data. In this algorithm, we built an in-
terpolated model by using both the labeled data
919
and the unlabeled data. This interpolated model
was employed ... 2006.
c
2006 Association for Computational Linguistics
Boosting Statistical Word Alignment Using
Labeled and Unlabeled Data
Hua Wu Haifeng Wang Zhanyi Liu
Toshiba (China) Research and Development...
- 8
- 451
- 1
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
Ngày tải lên :
18/02/2014, 14:20
... (CATATGGCTAGC
ATGCGCATATTGCTGAGTAAC) containing an NheI site
and an antisense primer (TTAGGATCCTTACCATTGCG
TGCCAACTCCCAC) containing a BamHI site. The gene
was cloned at the NheI and BamHI sites ... for
phosphorus scavenging and remobilization when the
cells are under stress and consequently mononucleotide
phosphate concentrations are high.
Materials and methods
Cloning and purification of St SurE
The ... S, Khachatr-
yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A,
Joachimiak A et al. (2001) Structure of Thermotoga
maritima stationary phase survival protein SurE: a
novel acid phosphatase. Structure...
- 10
- 553
- 0
How Do Earnings Change When Reservists Are Activated - A Reconciliation of Estimates Derived from Survey and Administrative Data docx
Ngày tải lên :
23/03/2014, 02:20
... attributable to activation derived from administrative data by year
activated, activation duration, pay grade, and military occupation. ere are numerous examples where administrative and
survey data ... JUSTICE
EDUCATION
ENERGY AND ENVIRONMENT
HEALTH AND HEALTH CARE
INTERNATIONAL AFFAIRS
NATIONAL SECURITY
POPULATION AND AGING
PUBLIC SAFETY
SCIENCE AND TECHNOLOGY
SUBSTANCE ABUSE
TERRORISM AND
HOMELAND ... and administrative data differ.
Matched SOFS-R and Administrative data
Our analyses employ a unique dataset consisting of individual SOFS-R responses matched to
administrative data on military...
- 74
- 228
- 0
Tài liệu DSXi™ Panels and Bays Connecting on a Whole New Level doc
Ngày tải lên :
21/12/2013, 07:15
... and bays, and you can save valuable floor space. By
configuring a low-profile 84-circuit DSXi panel measuring only four inches high,
you can increase your bay capacity from 11 standard panels ... That’s why
ADC, The Broadband Company
™
and the industry’s leading supplier of DSX-1
equipment, continues to innovate and enhance traditional DSX panels to
improve density, manageability, and ... Signal
Cross-connect) panels are an integral part of operating and maintaining
communications networks. As technology continues to become more
sophisticated, DSX panels remain at the very heart...
- 6
- 378
- 0
Tài liệu Editing and Updating Data in a Web Forms DataGrid pdf
Ngày tải lên :
26/01/2014, 10:20
... );
dataGrid.DataKeyField = "Id";
dataGrid.DataBind( );
}
private DataTable CreateDataSource( )
{
DataTable dt = new DataTable(TABLENAME);
// Create the DataAdapter and ... Session["DataSource"] = dt;
return dt;
}
private DataTable UpdateDataSource(DataTable dt)
{
// Create a DataAdapter for the update.
SqlDataAdapter da = new SqlDataAdapter("SELECT ... table and stores the DataTable to
a Session variable to cache the data source for the DataGrid.
UpdateDataSource( )
This method creates a DataAdapter and uses it with updating logic generated...
- 10
- 387
- 0
The 1998 bleaching event and its aftermath on a coral reef in Belize doc
Ngày tải lên :
07/03/2014, 17:20
... Service) and K.S. Casey
(NOAA/National Oceanographic Data Center) with SST data
and climatology processing, and K. Kilpatrick, E. Kearns, and
V. Halliwell (Rosenstiel School of Marine and Atmospheric ... at each station in each survey year.
Among-station means and standard errors for each depth and
survey year were calculated from those within-station means. The
pooled data, expressed as counts ... representation and as propor-
tional covers for statistical analysis. Repeated-measures analysis of
variance (ANOVA) was used to compare the proportional covers
of individual substrate components among...
- 13
- 583
- 0
Tài liệu Remittances from Germany and their Routes to Migrants'''' Origin Countries: A study on five selected countries docx
Ngày tải lên :
16/02/2014, 11:20
... Product
GDR German Democratic Republic
GTZ German Technical Cooperation
ILO International Labour Organisation
IMF International Monetary Fund
IOM International Organisation for Migration
KWG Kreditwesengesetz ... Germany, with
particular attention to Berlin and Hesse).
Hockenos, Paul (2003): Homeland-Calling. Exile
Patriotism and the Balkan-Wars.
International Labour Organization (1999): Migrant
Workers' ... Volksbank and
Raiffeisenbank banks in Rhineland-Westphalia, and
the commercial banks.
20
The central bank for the Volksbank and Raiffeisen-
bank banks.
21
Western Union's online list shows only...
- 28
- 374
- 0
Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx
Ngày tải lên :
19/02/2014, 16:20
... increasing the pH slightly to a value
of 7.3 dramatically altered the effect of phosphate and
activation was seen only at low concentrations with a
maximal 1.7-fold activation at 2 mm phosphate. At
Table ... °C was 7.5 and the pH at 37 °C was 7.2. The concentration of F6P was held at 0.5 m
M. All other
assay conditions are detailed in the Materials and methods. Data are means S.E.M., n ẳ 4 separate ... retained at 5 °C at pH 7.5 and indicate that changes
in kinetic parameters were most probably due to tem-
perature alone. Sensitivity to adenylates (ATP inhibi-
tion, AMP and ADP activation) was...
- 9
- 579
- 0
Tài liệu Báo cáo khoa học: "Learning with Unlabeled Data for Text Categorization Using Bootstrapping and Feature Projection Techniques" doc
Ngày tải lên :
20/02/2014, 16:20
... general, related approaches for using unlabeled
data in text categorization have two directions;
One builds classifiers from a combination of
labeled and unlabeled data (Nigam, 2001; Bennett
and ... labeled data.
While labeled data are difficult to obtain,
unlabeled data are readily available and plentiful.
Therefore, this paper advocates using a
bootstrapping framework and a feature projection ... second, we use the TCFP classifier with
robustness from noisy data (Ko and Seo, 2004).
How can labeled training data be automatically
created from unlabeled data and title words?
Maybe unlabeled...
- 8
- 443
- 0
COMBINING EVIDENCE ON AIR POLLUTION AND DAILY MORTALITY FROM THE 20 LARGEST US CITIES: A HIERARCHICAL MODELLING STRATEGY potx
Ngày tải lên :
06/03/2014, 16:20
... lag structure
and prior distributions.
2. Description of the databases
The analysis database included mortality, weather and air pollution data for the 20 largest
metropolitan areas in the USA ... a city has more than one weather-
station, we took the average of the measurements from all available stations. The PM
10
and
ozone O
3
data were also averaged over all monitors in a county. ... morbidity and
mortality from respiratory and cardiovascular diseases increase with levels of particulate air
pollution below the current national ambient air quality standard for particulate matter...
- 40
- 526
- 0
Báo cáo khoa học: "Japanese Named Entity Recognition based on a Simple Rule Generator and Decision Tree Learning" pdf
Ngày tải lên :
08/03/2014, 05:20
... Large Corpora.
Kiyotaka Uchimoto, Qing Ma, Masaki Murata, Hi-
romi Ozaku, Masao Utiyama, and Hitoshi Isahara.
2000. Named entity extraction based on a maxi-
mum entropy model and transformation ... .
According to this ordering, two candidates can
have the same rank. One of them might assert that
a certain word is an organization’s name and an-
other candidate might assert that it is a person’s
name. ... from <ORGANIZATION>OO-
SAKA-TO-YO-TA</ORGANIZATION> (= Os-
aka Toyota) because Japanese POS taggers know
that TO-YO-TA is an organization name (a kind
of proper noun).
*:*:location-name,...
- 8
- 530
- 0