learners centre of attention lay most at group of cognitive strategies which comprise of verbal and written repetition taking notes in class bilingual dictionary asking teacher for l1 translation the reasons of these strategies were discussed as follows
the reality of teaching and learning English listening skills in grade 10 at Yen Mo B high school, Ninh Binh province = Thực trạng dạy và học kỹ năng nghe tiếng
... effort The most common preparation that the teachers made before presenting the listening lessons was studying the listening text As for the students, the situation was even worse The findings ... stage was loved by 39.1% of the students About a third of the students indicated that they liked listening for the gist of the listening text, listening for detailed information of the listening ... which were indicated to be either very important or important by all the teachers Most of the teachers were influenced by the availability of the materials, the interest of the students and the...
- 80
- 1,202
- 3
The reality of teaching and learning English listening skills in grade 10 at Yen Mo B high school, Ninh Binh province
... practices in listening lessons - The teachers’ classroom practices in the pre-listening stage - The teachers’ classroom practices in the while-listening stage - The teachers’ classroom practices in the ... and classroom observations A detailed discussion of the findings is also presented in this chapter 3.1 Findings from questionnaires for the teachers and the students 3.1.1 The teachers’ and the ... encourage the students’ participation by asking them to read aloud the answers and engaging them in pair /group work However, the teachers still played the main role, and students’ speaking was limited...
- 9
- 1,158
- 8
Báo cáo y học: "Randomized trial comparing daily interruption of sedation and nursing-implemented sedation algorithm in medical intensive care unit patients"
... noted that investigators were not members of the DSMB and were not involved in the DSMB's data analysis The study was not terminated because of the finding of increased hospital mortality in patients ... of the cases, patients were receiving continuous infusions; in 4% of the cases, patients were receiving boluses; in the remaining 4% of the cases, patients were not receiving sedation as it had ... levels in patients randomly assigned to SA on two occasions per day, with the timing of the events being at the discretion of investigators and separated by at least hours DIS was performed initially...
- 9
- 605
- 0
Báo cáo y học: "A pilot study of rizatriptan and visually-induced motion sickness in migraineu"
... using the Wilcoxon rank-sum test Data regarding the amount of anxiety induced by the combinations of pain and visual motion based on SUDs indicated that during testing following ingestion of ... after beginning stripe viewing, the subject’s non-dominant hand was immersed in 32ºC water for minutes then immersed in 2ºC ice water for 30 seconds and then back into the warm bath Ice water immersion ... blinded container The investigator administering the drug, the technicians performing testing, and the subject were blinded to treatment assignment The Investigational Drug Service provided the unidentifiable...
- 6
- 504
- 0
Prediction of deformation and hygro-thermal stresses distribution in PEM fuel cell vehicle using threedimensional CFD model
... directly related to the temperature, where the temperature is highest in the centre of the channel and coincide with the highest reactant concentrations In addition, the deformation that occurs in MEA ... deformation in MEA are directly related to the increasing of current density, due to increasing of heat generation This result may explain the occurrence of cracks and pinholes in the membrane ... utilize in the simulation for the membrane The behaviour of the cell during operation has been studied and investigated under real operating conditions The results show that the non-uniform distribution...
- 20
- 384
- 0
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm
... create individuals for the new generation from the last generation (2) Mutation: In order to maintain genetic diversity, some of the individuals in the group are randomly altered After that, the ... induction factor, and rr is the rotor radius of the turbine The wind velocity in the wake at a distance x downstream can then be determined using the principle of conservation of momentum as: u = U [1 ... the third column were cited in reference [11] as the size of the tallest wind turbine in the U.S in 2005 The size of the farm considered is 50D x 50D and a wind with uniform speed of 12 m/s is considered...
- 12
- 635
- 1
A contrastive analysis of grammatical and semantic features of words and idioms related to hearing in english and vietnamese
... feature in semantic feature analysis within that system.” And “it is just the lexical meaning it is the most There are two classes of words: the open classes or full word-forms outstanding individual ... property of the word.” And the lexical and the closed classes or empty word-forms And in this paper, we meaning of the word can be classified in to denotational meaning and only focus on verb - one in ... the perceiving sound with sense of hearing deserves in classroom When teaching vocabulary, the teacher often Meaning 2: informs about listening attentively wastes time by explanation and definition,...
- 13
- 1,297
- 3
Tài liệu A Comparison of Conventional and Organic Milk Production Systems in the U.S. potx
... costs; and operating interest Capital ownership costs include the annualized cost of maintaining the capital investment (economic depreciation and interest) in the dairy operation, and costs for ... However, the prior research is limited in terms of the scope and the depth of data supporting the analyses This study addresses these limitations, taking advantage of a unique nationwide data set of ... items Total operating costs is an indicator of the relative success of dairy operations in terms of their ability to meet shortterm financial obligations The sum of operating and capital ownership...
- 30
- 660
- 0
Báo cáo khoa học: Inter-flavin electron transfer in cytochrome P450 reductase – effects of solvent and pH identify hidden complexity in mechanism potx
... chemical and pH gating mechanisms We were principally interested in the inter-avin ET reactions, so the pH dependence of the kinetic behaviour at 600 nm was analysed, reporting on the formation of the ... (down-triangles) The data for kfast (up phase) were tted to Eqn (4) masking the data point at pH 6.5, whereas a linear t was used for kslow (down phase) The effect of solvent-derived protons was further ... built up during the course of the reaction, but rather there is a (kinetic and or thermodynamic) quasi-equilibrium (QE) mixture of all states, as indicated by the [ ] Binding of another NADPH...
- 18
- 414
- 0
Báo cáo khoa học: "A Comparison and Semi-Quantitative Analysis of Words and Character-Bigrams as Features in Chinese Text Categorization" potx
... during the increase of dimensionality With these factors, the actual curves would not keep increasing as they in Figure b1,2 ⊂ w in which b1 and b2 stand for the two bigrams and w stands for ... kinds of bigrams by a division at -1.4 12 Overall Information Quantity of a Feature Space The performance limit of a classification is related to the quantity of information used So a quantitative ... experiment result on the LC document collection (the circles indicate the maximums and the dash-dot lines indicate the superior limit and the asymptotic interior limit of the bigram scheme) The word scheme...
- 8
- 492
- 0
Báo cáo khoa học: "Serial Combination of Rules and Statistics: A Case Study in Czech Tagging" potx
... finite-state automaton starting from the beginning of the sentence and passing to the right until it finds an input configuration on which it can operate by deletion of some parts of the input Having ... and at the same time the most accurate tagging of Czech texts ¢ 1.2 eliminating the incorrect alternatives2 , rather than picking the correct one under all circumstances Moreover, the rule-based ... Manual Rule-based Systems The idea of tagging by means of hand -written disambiguation rules has been put forward and implemented for the first time in the form of Constraint-Based Grammars (Karlsson...
- 8
- 518
- 0
Báo cáo khoa học: Mutagenesis of hydrogenase accessory genes of Synechocystis sp. PCC 6803 Additional homologues of hypA and hypB are not active in hydrogenase maturation ppt
... clearly assign the substrate of SpeB2 [22] Agmatinases belong to arginase-related enzymes that catalyse the splitting of guanidinium groups to urea and amino compounds Arginases are known to contain ... volume of m LiCl was added and the mixture was incubated for 1.5 h at )20 °C The DNA-containing supernatant was removed after centrifuging at 18 000 g for 30 at )8 °C The LiCl precipitation of RNA ... CTTGTCGACTGGAGTCCTAACAAATACGG CATATGTTAAAAACCGTTGCCATACAG GGATCCAGTTGAGTTAACAGATATATTGC CATATGCCAGGCCAATCCACCA ATTTTGAGGATCCCTTGGCTTTATC GTGGACTTGATTAGTTAATT TGCTCAATCAATCACCGGATCCCTCCG CCCCTTGGTATTGGGGGAGAGAT TTGGCACCCAGCCTGCGCGATTAAAGT...
- 12
- 415
- 0
Use of algae and aquatic macrophytes as feed in small-scale aquaculture
... 531 The designations employed and the presentation of material in this information product not imply the expression of any opinion whatsoever on the part of the Food and Agriculture Organization ... of the duckweed leaf (Leng, Stambolie and Bell, 1995) There are at least three methods of fertilizer application including broadcasting, dissolving in the water column of the plot, and spraying ... the efficacy of Lemna and Azolla as biofilters of nitrogen and phosphate in fish ponds in Bangladesh and found that they removed the excess amount of nutrients from the water body and maintained...
- 135
- 619
- 0
Preferences of the Central Reserve Bank of Peru and optimal monetary policy rules in the inflation targeting regime ppt
... taken into consideration Therefore, in the fourth case, a zero weight was used for interest rate smoothing and equal weights for the stabilization of inflation and output The fifth case encompasses ... points after two periods Therefore, an increase in the real interest rate of one percentage point at time t causes a reduction of 0.02 percentage points in the inflation rate at t+4 However, these ... obtained by the calibration strategy and the true interest rate path approximated by the interbank rate.32 Note that the optimal interest rate captures the main movements of the observed interest...
- 37
- 561
- 0
Báo cáo Y học: Functional integration of mitochondrial and hydrogenosomal ADP/ATP carriers in the Escherichia coli membrane reveals different biochemical characteristics for plants, mammals and anaerobic chytrids pdf
... containing the indicated additions and incubated for 1.5 at room temperature The cells were sedimented for at room temperature in an eppendorf centrifuge (5000 g) The supernatents were transferred ... membranes of the induced E coli cells using an anti-His Ig have corroborated the integration of the AACs into the bacterial membrane (data not shown) Not even traces of the recombinant proteins were ... However, the rates are linear only for about 10 The ratios of ADP to ATP uptake into E coli cells expressing the plant AACs were significantly lower (Fig 2A) than the ratios of ADP to ATP uptake of the...
- 10
- 486
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25