lau g k zhou y yuen st lin m c kung h f and chiu j f 2003 quot serum biomarkers of hepatitis b virus infected liver inflammation a proteomic study quot proteomics 3 5 666 674

Báo cáo y học: "Epidemiology and Prevention of Hepatitis B Virus Infection"

Báo cáo y học: "Epidemiology and Prevention of Hepatitis B Virus Infection"

Ngày tải lên : 02/11/2012, 11:12
... A mass vaccination program in Taiwan against hepatitis < /b> B virus infection in infants of < /b> hepatitis < /b> B surface antigen-carrier mothers JAMA 1987; 257 : 259 7-26 03 73 Hsu HM, Chen DS, Chuang CH, Lu JC, ... Taiwan and < /b> the incidence of < /b> hepatocellular carcinoma in children Taiwan Childhood Hepatoma Study Group N Engl J < /b> Med 1997 ;33 6:1 855 -1 859 78 Li R, Yang J,< /b> Gong J,< /b> Li Y,< /b> Huang Z, Fang K,< /b> et al Efficacy ... A case-control study for clinical and < /b> molecular biological differences between hepatitis < /b> B viruses of < /b> genotype B and < /b> C < /b> Hepatology 2001 ;33 :218-2 23 Chu CJ, Hussain M,< /b> Lok AS Hepatitis < /b> B virus genotype...
  • 8
  • 643
  • 0
Báo cáo y học: "Natural History and Clinical Consequences of Hepatitis B Virus Infection"

Báo cáo y học: "Natural History and Clinical Consequences of Hepatitis B Virus Infection"

Ngày tải lên : 02/11/2012, 11:17
... establishes, the serology markers like HBeAg, HBeAb and < /b> HBsAb can be positive or negative except HBsAg and < /b> HBcAb (IgG form) remain positive HBeAg positive chronic hepatitis < /b> B Age at the time of < /b> infection ... phase clinically presents as HBsAg carrier * During the stage of < /b> reactivation, majority of < /b> patients remain HBeAg negative with positive HBeAb and < /b> their clinical presentation can be HBeAg negative ... risk of < /b> hepatocellular carcinoma in cirrhosis Cancer 1994;74:2442-8 31 Tsai JF, Jeng JE, Ho MS, Chang WY et al Effect of < /b> hepatitis < /b> C < /b> and < /b> B virus infection on risk of < /b> hepatocellular carcinoma: a...
  • 5
  • 450
  • 0
Báo cáo y học: "i: Randomized controlled trial of Hepatitis B virus vaccine in HIV-1-infected patients comparing two different doses" ppt

Báo cáo y học: "i: Randomized controlled trial of Hepatitis B virus vaccine in HIV-1-infected patients comparing two different doses" ppt

Ngày tải lên : 10/08/2014, 05:20
... purposes) AIDS Research and < /b> Therapy 2006, 3: 9 http://www.aidsrestherapy.com/content /3/ 1/9 Table 1: Characteristics of < /b> HIV -infected patients Baseline clinical and < /b> demographic characteristics of < /b> HIV -infected ... immunogenicity and < /b> efficacy of < /b> hepatitis < /b> B vaccine in homosexual men N Engl J < /b> Med 1986, 31 5: 209-214 Beekmann S, Doebbeling B: Frontiers of < /b> occupational health New vaccines, new prophylactic regimens, and < /b> ... granulocyte-macrophage colony-stimulating factor (GM-CSF) as a vaccine adjuvant for hepatitis < /b> B virus in patients with HIV infection Vaccine 20 03, < /b> 21: 454 5- 454 9 Hadler S, Francis D, Maynard J:< /b> Long-term immunogenicity...
  • 5
  • 361
  • 0
Báo cáo y học: " An overview of treatment response rates to various anti-viral drugs in Pakistani Hepatitis B Virus infected patients" doc

Báo cáo y học: " An overview of treatment response rates to various anti-viral drugs in Pakistani Hepatitis B Virus infected patients" doc

Ngày tải lên : 11/08/2014, 21:21
... Seroprevalence of < /b> hepatitis < /b> B and < /b> C < /b> genotypes among yung apparently healthy females of < /b> Karachi-Pakistan Libyan J < /b> Med 2008, 3: 66-70, AOP: 0711 23 43 Alam MM, Zaidi SZ, Shaukat S, Sharif S, Angez M,< /b> Naeem ... disease Hepatology 20 03, < /b> 37 :19-26 Orito E, Mizokami M,< /b> Sakugawa H,< /b> Michitaka K,< /b> Ishikawa K,< /b> Ichida T, et al: A case-control study for clinical and < /b> molecular biological differences between hepatitis < /b> ... the treatment of < /b> hepatitis < /b> B e antigen-positive chronic hepatitis < /b> B J < /b> Viral Hepat 20 03, < /b> 10:298 -30 5 35 Okamoto H,< /b> Tsuda F,< /b> Sakugawa H,< /b> Sastrosoewinjo RI, Imai M,< /b> Miyakawa Y,< /b> Mayumi M:< /b> Typing hepatitis...
  • 4
  • 342
  • 0
Báo cáo y học: " Characterization of Hepatitis B virus (HBV) genotypes in patients from Rondônia, Brazil" doc

Báo cáo y học: " Characterization of Hepatitis B virus (HBV) genotypes in patients from Rondônia, Brazil" doc

Ngày tải lên : 12/08/2014, 02:20
... Kurbanov F,< /b> Tanaka Y,< /b> Fujiwara K,< /b> Sugauchi F,< /b> Mbanya D, Zekeng L, Ndembi N, Ngansop C,< /b> Kaptue L, Miura T, Ido E, Hayami M,< /b> Ichimura H,< /b> Mizokami M:< /b> A new subtype (subgenotype) Ac (A3 ) of < /b> hepatitis < /b> B virus ... history, that was built by many African-descendants workers in the beginning of < /b> twentieth century Most of < /b> them had come from the Caribbean Barbados in a different context from most of < /b> the slaves ... hepatitis < /b> B J < /b> Clin Virol 20 05, 32 : 53 - 59 55 Mello FC, Souto FJ, Nabuco LC, Villela-Nogueira CA, Coelho HS, Franz HC, Saraiva JC, Virgolino HA, Motta-Castro AR, Melo MM, Martins RM, Gomes SA: Hepatitis...
  • 7
  • 533
  • 0
Báo cáo y học: "A novel nucleotide insertion in S gene of hepatitis B virus in a chronic carrier" pps

Báo cáo y học: "A novel nucleotide insertion in S gene of hepatitis B virus in a chronic carrier" pps

Ngày tải lên : 12/08/2014, 04:20
... with chronic hepatitis < /b> B J < /b> Gen Virol 1996, 77:18 25- 1 831 Yamamoto K,< /b> Horikita M,< /b> Tsuda F,< /b> Itoh K,< /b> Akahane Y,< /b> Yotsumoto S, Okamoto H,< /b> Miyakawa Y,< /b> Mayumi M:< /b> Naturally occurring escape mutants of < /b> hepatitis < /b> ... clon17-clone19, also forming a possible N-Linked glycosylation site(figure 2) C1< /b> 2 1Y(< /b> TGC®TAC), T126S/T12 6A( ACT®TCT or ACT®GCT), Q12 9K(< /b> CAA®AAA), G1< /b> 30 R(GGA® AGA), G1< /b> 45R(GGA®AGA) and < /b> other aa substitution compared ... load and < /b> HBsAg and < /b> HBeAg status with age in HBV chronic carriers in The Gambia Virol J < /b> 2008, 5: 49 Ashton-Rickardt PA, Murray K:< /b> Mutants of < /b> the hepatitis < /b> b virus surface antigen that define some...
  • 5
  • 381
  • 0
Báo cáo y học: " Seropositivity of Hepatitis B virus and Hepatitis C virus dual Infection among blood donors in Nyala Teaching Hospital" pot

Báo cáo y học: " Seropositivity of Hepatitis B virus and Hepatitis C virus dual Infection among blood donors in Nyala Teaching Hospital" pot

Ngày tải lên : 12/08/2014, 04:21
... 79:1 132 -1 136 Kalinowska-Nowak A, Bociaga-Jasik M,< /b> Garlicki A, Skwara P: Prevalence of < /b> hepatotropic viruses HBV and < /b> HCV in HIV -infected patients from Southern region of < /b> Poland Acta virologica 2000, ... virological characteristics among patients with single occult hepatitis < /b> B virus (HBV), single occult hepatitis < /b> C < /b> virus (HCV) and < /b> occult HBV and < /b> HCV dual infection Journal of < /b> Medical Virology 2007, ... Reddy GA, Dakshinamurthy KV, Neelaprasad P, Gangadhar T, Lakshmi V: Prevalence of < /b> HBV and < /b> HCV dual infection in patients Publish with Bio Med Central and < /b> every scientist can read your work free of...
  • 2
  • 348
  • 0
Báo cáo y học: "Aplasia and Agenesis of the Frontal Sinus in Turkish Individuals: A Retrospective Study Using Dental Volumetric Tomograph"

Báo cáo y học: "Aplasia and Agenesis of the Frontal Sinus in Turkish Individuals: A Retrospective Study Using Dental Volumetric Tomograph"

Ngày tải lên : 25/10/2012, 11:04
... Asian Pac J < /b> Allergy Immunol 2006;24:1 23- 7 Schaeffer J < /b> The Embryology, Development and < /b> Anatomy of < /b> the Nose, Paranasal Sinuses, Nasolacrimal Passageways and < /b> Olfactory Organs in Man Philadelphia: ... Blakiston’s Son; 1920 Som PM, cCurtin HD Head and < /b> neck imaging In: Som PM, Shugar JMA, Brandwein MS, eds Anatomy and < /b> Physiology, 4th ed St < /b> Louis: Mosby; 20 03: < /b> 98-100 Dodd G,< /b> Jing B Radiology of < /b> ... Eskimo population Am J < /b> Phys Anthropol 1980; 53 : 251 -5 23 Harris AMP, Wood RE, Nortje CJ, Thomas CJ Gender and < /b> ethnic differences of < /b> the radiographic image of < /b> the frontal region J < /b> Forensic Odontostomatol...
  • 5
  • 577
  • 0
Báo cáo y học: "Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) Dual Infection"

Báo cáo y học: "Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) Dual Infection"

Ngày tải lên : 02/11/2012, 09:51
... 60 Dual Infection of < /b> HBV and < /b> HCV and < /b> hepatocellular carcinoma (HCC) Conflict of < /b> interest HBV and < /b> HCV infections are confirmed causes of < /b> HCC What’s the combined effect of < /b> HBV and < /b> HCV coinfection ... and < /b> C < /b> and < /b> the risk of < /b> hepatocellular carcinoma in West Africa Hepatology 2004 ;39 :211-219 54 Saito I, Miyamura T, Ohbayashi A, Harada H,< /b> Katayama T, Kikuchi S, Watanabe Y,< /b> et al Hepatitis < /b> C < /b> virus ... The suggestion that dual infection of < /b> HBV and < /b> HCV may enhance the severity of < /b> hepatitis < /b> was also supported by histological evidence Zarski [24] compared the histological characteristics of < /b> patients...
  • 6
  • 621
  • 1
Báo cáo y học: "Enhanced surveillance for childhood hepatitis B virus infection in Canada, 1999-2003"

Báo cáo y học: "Enhanced surveillance for childhood hepatitis B virus infection in Canada, 1999-2003"

Ngày tải lên : 02/11/2012, 11:08
... regression model adjusted for birthplace, age and < /b> calendar year, and < /b> interactions between birthplace and < /b> age, birthplace and < /b> calendar year Figure Annual rates of < /b> newly identified cases among children ... despite a growing number of < /b> chronic HBV-carriers [14, 15] The risk of < /b> transmission may increase when the children with chronic HBV infection reach adulthood and < /b> establish sexual contacts The analysis ... asymptomatic While these factors may affect the yearly incidence estimate, changes in the incidence rate would be reliable as long as the proportion of < /b> asymptomatic cases remained constant We focused...
  • 4
  • 399
  • 0
Báo cáo y học: "Hepatitis B Virus e Antigen Variants"

Báo cáo y học: "Hepatitis B Virus e Antigen Variants"

Ngày tải lên : 03/11/2012, 09:46
... serological markers during a typical course of < /b> infection The first stage is characterized by the presence of < /b> HBsAg, HBeAg, and < /b> IgM class of < /b> anti-HBc antibodies, and < /b> may last for decades In the intermediate ... 70: 58 45- 5 851 Carman W, Jacyna M,< /b> Hadziyannis S, Karayiannis P, McGarvey M,< /b> Makris A, and < /b> Thomas H < /b> Mutation preventing formation of < /b> the hepatitis < /b> B e antigen in patients with chronic hepatitis < /b> B ... characterization in chimpanzees Virology 19 93 194: 2 63- 276 Okamoto H,< /b> Tsuda F,< /b> Akahane Y,< /b> Sugai Y,< /b> Yoshiba M,< /b> Moriyama K,< /b> Tanaka T, Miyakawa Y,< /b> and < /b> Mayumi M < /b> Hepatitis < /b> B virus with mutations in the core...
  • 6
  • 498
  • 0
Báo cáo y học: "Study of the early steps of the Hepatitis B Virus life cycle"

Báo cáo y học: "Study of the early steps of the Hepatitis B Virus life cycle"

Ngày tải lên : 03/11/2012, 10:09
... 120-1 45 region of < /b> the hepatitis < /b> B virus envelope are virus neutralizing Vaccine 1986 4(1): 35 -7 34 Machida A, Kishimoto S, Ohnuma H,< /b> Miyamoto H,< /b> Baba K,< /b> Oda K,< /b> Nakamura T, Miyakawa Y,< /b> Mayumi M < /b> A hepatitis < /b> ... Nucleonic Inc (PA USA) Drs Satishchandran C < /b> and < /b> Cathy Pachuk (Nucleonics Inc, PA, USA), Baohua Gao and < /b> Tienlun Zhou < /b> (Thomas Jefferson university, USA) are thankful for their comments Conflict of < /b> interest: ... Pontisso and < /b> his colleagues, using the membranes of < /b> surgically obtained human liver as a target, further confirmed the role of < /b> LHBs in the HBV attachment [ 23] Recently, the attachment site of < /b> LHBs was...
  • 13
  • 654
  • 1
Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt

Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt

Ngày tải lên : 22/02/2014, 07:20
... with FcR c-< /b> chain Fig FcR c-< /b> chain and < /b> the cytoplasmic tail of < /b> GPVI are necessary to initiate the GPVI signalling cascade (A) K5< /b> 62 cells stably transfected with FcR c-< /b> chain and < /b> cotransfected with ... requirement for the cytoplasmic tail in the association with FcR c-< /b> chain The lack of < /b> association between the FcR c-< /b> chain and < /b> a mutant GPVI lacking its cytoplasmic tail explains the failure of < /b> the mutant ... cytomix buffer (120 mM KCl, 0 .5 mM CaCl2, 10 mM K2< /b> HPO4, 10 mM KH2PO4, 25 mM Hepes, mM EGTA, mM MgCl2, pH 7.6 adjusted with KOH) supplemented on the day of < /b> experiment with mM glutathione and < /b> mM...
  • 10
  • 506
  • 0
Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

Ngày tải lên : 08/03/2014, 16:20
... E26 4A C2< /b> 7 1A C2< /b> 9 5A W31 5A C3< /b> 2 6A AAATGAGCCCAACAAAGCCGAGAAAAACATT AATTTGATGCTCGACAGGCTGCCGCGGAGACATGG CAATCCGGGAGACAGCTGGTGATGAAAA TAGCCACACTTGCAGCCGCGGCCAAAAATG TTAATGGGGATGAGAGCGGTTGCCACTTTCT AGATGGGTTGGCAACTTTCGCTTCAAAA ... AGATGGGTTGGCAACTTTCGCTTCAAAA TGAAAACCGCCAGTGCTATTGCTGTGAACA CCTGACAGCAACTACGCAGCGTTCTGTTCAG AGCAACTATCCACCGTTCGCTTCAGGGACTG TGCTTCATCTTGCTGACGTGTACGTGGGACT ATGTGTACGTGGGACTGGCACTTCGAAAGC AAAATGGCCTACAGTTTAGCTCGGTACC ... AAAATGGCCTACAGTTTAGCTCGGTACC CAGAATCGCCAATGACATGTCAAGGAAGAAGCATCTGAGATGTTAGTCTAGATAT GTCAAGGAAGAAGCATCTGAGAGCCTAGTCTAGATAT named according to the amino-acid residues substituted by alanine and < /b> their...
  • 7
  • 404
  • 0
Báo cáo y học: " laboratory driving simulation for assessment of driving behavior in adults with ADHD: a controlled study" docx

Báo cáo y học: " laboratory driving simulation for assessment of driving behavior in adults with ADHD: a controlled study" docx

Ngày tải lên : 08/08/2014, 21:20
... advisory board for the following pharmaceutical companies: Shire Laboratories, Inc and < /b> Eli Lilly & Company, Glaxo-Smith Kline, Pfizer Pharmaceutical, McNeil Pharmaceutical, and < /b> Novartis Pharmaceutical ... full access to all of < /b> the data in the study and < /b> takes responsibility for the integrity of < /b> the data and < /b> the accuracy of < /b> the data analysis References Authors' contributions JB: Had full access to all ... following sources: Shire Laboratories, Inc and < /b> Eli Lilly & Company, Glaxo-Smith Kline, Pfizer Pharmaceutical, McNeil Pharmaceutical, Novartis Pharmaceutical, and < /b> NIMH Dr Thomas Spencer is a speaker for...
  • 7
  • 421
  • 0
Báo cáo y học: "Colour duplex sonography of temporal arteries before decision for biopsy: a prospective study in 55 patients with suspected giant cell arteritis" pptx

Báo cáo y học: "Colour duplex sonography of temporal arteries before decision for biopsy: a prospective study in 55 patients with suspected giant cell arteritis" pptx

Ngày tải lên : 09/08/2014, 08:22
... sites of < /b> the artery Although an inflammatory wall thickening was evident along the whole length of < /b> a particular branch in some cases, a segmental, patchy appearance of < /b> distinct, well-defined halos ... was then confirmed by follow-up and < /b> histology Baseline clinical characteristics in GCA (mean age 70, range 52 –90 years, 13 women) and < /b> non-GCA patients (mean age 74, range 50 –91 years, 17 women) ... ESR of < /b> 50 mm/ hour or more, new headache onset, jaw claudication, fever, polymyalgia rheumatica, temporal artery tenderness, and < /b> recent visual impairment Table Baseline characteristics and < /b> final...
  • 8
  • 268
  • 0
Báo cáo y học: "The identification of unique serum proteins of HIV-1 latently infected long-term non-progressor patients" doc

Báo cáo y học: "The identification of unique serum proteins of HIV-1 latently infected long-term non-progressor patients" doc

Ngày tải lên : 10/08/2014, 05:21
... Miura T, Ikeda S, Sakai M,< /b> Fujii T, Takahashi Y,< /b> Oka S, Matsuda J,< /b> Ishikawa M,< /b> Taki M,< /b> Takashima Y,< /b> Mimaya J,< /b> Ito M,< /b> Kimura A, Yasunami M:< /b> HLA -B polymorphism in Japanese HIV-1 -infected long-term ... Rosenzweig JM, Cameron B, Wang YY, Meng XY, Berchuck A, Van Haaften-Day C,< /b> Hacker NF, de Bruijn HW, van der Zee AG, Jacobs IJ, Fung ET, Chan DW: Three biomarkers < /b> identified from serum < /b> proteomic analysis ... would like to thank the members of < /b> the Kashanchi lab for experiments and < /b> assistance with the manuscript We thank Dr Ming-Daw Tsai (Institute of < /b> Biological Chemistry, Academia Sinica) for the GST-p16INK4A...
  • 17
  • 306
  • 0
Báo cáo y học: "The accuracy of echocardiography versus surgical and pathological classification of patients with ruptured mitral chordae tendineae: a large study in a Chinese cardiovascular center" ppt

Báo cáo y học: "The accuracy of echocardiography versus surgical and pathological classification of patients with ruptured mitral chordae tendineae: a large study in a Chinese cardiovascular center" ppt

Ngày tải lên : 10/08/2014, 09:22
... Shukunami C,< /b> Hakuno D, Yoshioka M,< /b> Miura S, Docheva D, Kimura T, Okada Y,< /b> Matsumura G,< /b> Shin’oka T, Yozu R, Kobayashi J,< /b> IshibashiUeda H,< /b> Hiraki Y,< /b> Fukuda K:< /b> Local tenomodulin absence, angiogenesis, ... with a high accuracy, and < /b> it played an important role in classification This large RMCT study on echocardiography, surgery and < /b> pathology provided characteristics and < /b> details of < /b> RMCT We found that ... tests of < /b> thoracic echocardiography (TTE) and < /b> transesophageal echocardiography (TEE) with the gold standards of < /b> surgical findings and < /b> pathological examination Materials and < /b> methods Patients and...
  • 7
  • 279
  • 0
Báo cáo y học: " Discovery of serum biomarkers of alcoholic fatty liver in a rodent model: C-reactive protein" doc

Báo cáo y học: " Discovery of serum biomarkers of alcoholic fatty liver in a rodent model: C-reactive protein" doc

Ngày tải lên : 10/08/2014, 10:20
... suggests that alcohol abuse may cause fatty liver and < /b> induce high serum < /b> CRP levels, indicating that CRP may be qualified as a unique biomarker of < /b> AFL Administration of < /b> ethanol can elicit oxidative stress ... CRP as a surveillance marker of < /b> alcoholinduced fatty liver in a rodent model, which may help diagnose early alcohol-induced pathophysiological alterations in clinical practice Materials and < /b> methods ... in NASH and < /b> HCV -infected liver fibrosis although we found that Hp may be higher in the serum < /b> of < /b> NAFL rats The results demonstrated that Hp is a reliable downregulated biomarker of < /b> NASH and < /b> liver...
  • 10
  • 486
  • 0
Báo cáo y học: " Infection with hepatitis B virus carrying novel pre-S/S gene mutations in female siblings vaccinated at birth: two case reports" pot

Báo cáo y học: " Infection with hepatitis B virus carrying novel pre-S/S gene mutations in female siblings vaccinated at birth: two case reports" pot

Ngày tải lên : 11/08/2014, 12:20
... g/< /b> mL proteinase K)< /b> and < /b> incubated at 65 C < /b> for three hours After phenol-chloroform extraction, DNA was subjected to polymerase chain reaction (PCR) The primers were P1, TTGGGAACAAGAGCTACAGC ATGG ... TY, Jan CF: Seroprevalence of < /b> hepatitis < /b> B viral markers among freshmen 20 years after mass hepatitis < /b> B vaccination program in Taiwan J < /b> Formos Med Assoc 2007, 106(7) :5 13- 51 9 Hsu HY, Chang MH, ... Research Program (CMRPG 37 0691) Author Details 1Division of < /b> Pediatric Gastroenterology, Chang Gung Children's Hospital, Taoyuan, Taiwan, 2Graduate Institute of < /b> Clinical Medical Science, Chang Gung...
  • 5
  • 218
  • 0