land is not just a resource to be exploited but a crucial vehicle for the achievement of improved socio economic biological and physical environments food and agriculture organization fao of the united nations 1999

def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio

Ngày tải lên : 11/09/2015, 16:06

... serves as a tissue for haematopoiesis during gestation, the vascular development in liver is essential Angioblasts, precursors of endothelial cells, start to appear near the hepatoblasts at the stage ... required for the proliferation and migration of hepatoblasts (Matsumoto et al., 2001) The formation of liver bud is also related to other transcription factors, such as Hex and Prox1 The studies of ... during pancreas organogenesis have revealed that the pancreatic precursors already exist before the formation of pancreas buds As early as 14 hpf, the precursors of pancreatic cells are already positioned...

199
296
0

Innovation plays a crucial role for the success of the business

Ngày tải lên : 12/09/2017, 16:13

... c o m The innovation of starbucks a • Technology Social media : “Social media is a natural extension of our brand because we want to things that are unexpected and to speak to all sorts of people ... Example The KAfe coffee chain in Viet Nam closed + Menu is not changed, not refresh and new + Not paying appropriate attention to the local’s taste and demand +No style of decoration and design of ... start by selling coffee beans in Seattle’s Pike We add handcrafted espresso beverages to the Place Market menu 2011 1992 We mark 40 years and begin the next chapter in We become a publicly traded...

17
392
1

Báo cáo Y học: Arginine 121 is a crucial residue for the speciﬁc cytotoxic activity of the ribotoxin a-sarcin potx

Ngày tải lên : 31/03/2014, 23:20

... [18,19] The behaviour of a- sarcin against ApA as a function of pH, altogether with the characterization of the individual pKa values of the active site residues, were consistent with the existence of ... quantitative analysis of the ribonuclease activity of a- sarcin has been developed by using the dinucleotide ApA as substrate [18] Both mutant variants hydrolysed ApA They displayed a Km value similar to ... A very similar result has been obtained before for the H50Q variant, while mutation of either Glu96 or His137, residues acting as the general acid and base on the catalysis by a- sarcin [19,20],...

7
434
0

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Ngày tải lên : 18/06/2014, 16:20

... several years, and is only diagnosed once most of the damage to the pancreas has already been done Insights into human pathogenesis are scarce, but the NOD model displays a step-wise pathogenesis, ... underway to assess the effects and benefits of this double therapy Combination therapy with cellular infusion The idea of cellular therapy has also been examined The major challenge in this case is the ... Health Center, 1650 Cedar Avenue, Montreal, H3G 1A4 , Qc, Canada Full list of author information is available at the end of the article thymic and peripheral CD4+ T cells in humans and mice, and...

12
573
0

Báo cáo sinh học: " A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot

Ngày tải lên : 18/06/2014, 22:20

... of all dot plots and wrote parts of the manuscript LP coordinated the collection and assembly of data, did all statistical analysis and was involved in the interpretation of the data and manuscript ... out of range”) Data acquisition Individual laboratories acquired the data on their flowcytometer and analyzed the FCS files following laboratory-specific analysis strategies and software The ... proficiency panel leader and mainly involved at all stages of the project, including organizational and scientific aspects, data analysis and interpretation as well as manuscript writing and approval All...

13
752
0

o cáo hóa học:" A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot

Ngày tải lên : 20/06/2014, 04:20

... of all dot plots and wrote parts of the manuscript LP coordinated the collection and assembly of data, did all statistical analysis and was involved in the interpretation of the data and manuscript ... out of range”) Data acquisition Individual laboratories acquired the data on their flowcytometer and analyzed the FCS files following laboratory-specific analysis strategies and software The ... proficiency panel leader and mainly involved at all stages of the project, including organizational and scientific aspects, data analysis and interpretation as well as manuscript writing and approval All...

13
579
0

Báo cáo y học: " A multi-center, randomized, double-blind, parallel, placebo-controlled trial to evaluate the efficacy, safety, and pharmacokinetics of intravenous ibuprofen for the treatment of fever in critically ill and non-critically ill adults" pdf

Ngày tải lên : 13/08/2014, 21:20

... made substantial contributions to the conception and design of the study, acquisition of data and the interpretation of data PM and PW drafted the manuscript and PM, JP, KG, PW and MA revised it ... blinded to the assigned treatment until all patients had completed the protocol and after the study database had been analyzed Randomization codes were generated using a pseudo-random number generator ... linear trapezoidal rule up to time to maximum concentration, and then a log trapezoidal rule for the remainder of the curve, where the last measurable time is at Hour All statistical computations...

13
369
0

The Potential of Biofumigants as Alternatives to Methyl Bromide for the Control of Pest Infestation in Grain and Dry Food Products

Ngày tải lên : 25/10/2013, 05:20

... dominica Salvia fruticosa Salvia of cinalis Salvia sclarea Satureja thymbra Thymus vulgaris Geraniaceae Apiaceae Apiaceae Lamiaceae Rutaceae Lamiaceae Lamiaceae Lamiaceae Lamiaceae Lamiaceae Lamiaceae ... vulgare Laurus nobilis Lavandula of cinalis Majorana siriaca Matricaria camomilla Mentha piperita M rotundifolia Apiaceae Apiaceae Poaceae Apiaceae Lauraceae Lamiaceae Lamiaceae Asteraceae Lamiaceae ... food and beverages, is a good indication of their relative safety to warm-blooded animals and humans They are also classiﬁed as generally recognized as safe (GRAS) The ultimate goal is the introduction...

20
483
0

Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

Ngày tải lên : 14/02/2014, 13:20

... available, affordable and attractive involves taking account of mainstreaming nutrition and physical activity into all relevant policies at local, regional, national and European levels, creating ... ensure that walking, cycling and other forms of exercise are easy and safe, and address non-motorised modes of transportation The provision of safe cycling and walking paths to schools could be one ... chronic diseases” I STATE OF PLAY AT EUROPEAN LEVEL I.1 Unhealthy diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, and the rising prevalence...

22
703
0

Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf

Ngày tải lên : 16/02/2014, 06:20

... Thus, the left-hand sides of (3.31) and (3.60) are the same for this choice of Λ We leave it to the reader to check that the right-hand side of (3.60) is at least as large as the right-hand side of ... we again leave to the reader For the various estimates we have to take all tk large This will automatically be the case if r is large; we shall not explicitly mention this in the estimates below ... history and have become the ﬁrst goal of many investigations of stochastic growth models To the best of our knowledge Eden (see [E]) was the ﬁrst one to ask for a shape theorem for his celebrated...

67
490
0

Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx

Ngày tải lên : 16/02/2014, 22:20

... and thus impairs the quality of the milk The rapid determination of acidity may be made in an approximate manner so as to serve as a test at the weigh-can or intake The test is best made by the ... bacterial action, and is largely attributable to the physical property which milk possesses of being able to absorb volatile odors, the fat in particular, having a great affinity for many of these ... milk pails have been devised for this purpose In one case the pail is smaller at the top than bottom, but in most of them the common form is kept and the exposed area is lessened by means of a cover,...

201
540
0

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Ngày tải lên : 18/02/2014, 02:20

... of assistance The use of law can force a behavior that is desirable to the target but is not viable because of pressure to conform to a different standard In this case, the law can provide an external ... resistant to behave resistant to behave law marketing, law unable to behave resistant to behave resistant to behave education, marketing education, marketing, law education, marketing, law Carrots, ... externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The relationship of behavior management...

14
780
0

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

Ngày tải lên : 19/02/2014, 06:20

... HepG2 and HeLa cells were cultured for 48 h under normoxia or hypoxia, and then harvested The microsome fraction was prepared and used for the assay of HO activity The data are means ± SEM of three ... (1998) Databases on transcriptional regulation: TRANSFAC, TRRD and COMPEL Nucleic Acids Res 26, 362–367 47 Takahashi S, Takahashi Y, Ito K, Nagano T, Shibahara S & Miura T (1999) Positive and negative ... total RNA The lane labeled h contained RNA prepared from untreated cells harvested just before starting the experiment At the bottom of each panel, 28S rRNA of each sample was visualized by ethidium...

12
621
0

Physics of the Impossible: A Scientific Exploration into the World of Phasers, Force Fields, Teleportation, and Time Travel

Ngày tải lên : 05/03/2014, 16:15

... matter, but the most common form of matter in the universe is plasma, a gas of ionized atoms Because the atoms of a plasma are ripped apart, with electrons torn off the atom, the atoms are electrically ... youth, he was illiterate in mathematics, and as a consequence his notebooks are full not of equations but of hand-drawn diagrams of these lines of force Ironically, his lack of mathematical training ... sense, was the opposite of Michael Faraday Whereas Faraday had superb experimental instincts but no formal training whatsoever, Maxwell, a contemporary of Faraday, was a master of advanced mathematics...

353
550
0

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Ngày tải lên : 07/03/2014, 10:20

... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... to the amyloid pathology of AD Relative to the soluble Ab burden of the AD brain, a recent study described a mechanism by which decreased intracellular metal bioavailability may contribute to the ... disrupt Ab–metal interactions may prevent more than Ab aggregation and plaque formation Tau The native function of the microtubule-associated protein tau is to maintain integrity of the cytoskeleton...

9
634
0

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Ngày tải lên : 07/03/2014, 12:20

... Primers with the following sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox ... the dissemination and assembly of detoxiﬁcation pathways that can form part of genomic islands and have both pathogenicity and degradation functions [39] Remarkably, several l-gulono-1,4-lactone ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of...

11
571
0

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Ngày tải lên : 23/03/2014, 15:21

... this alga, and the absence of this gene in the cyanelle genome suggested that this gene has been transferred to the nuclear genome in this organism, as in the case of red algae On the other hand, ... anti-(C-PsbU) A D Fig Reactivities of the thylakoid membranes isolated from Cheaeotoceros gracilis (A) , Pavlova gyrans (B), Laminria japonica (C) and Undaria pinnatiﬁda (D) with antibodies raised against ... in the algae of red lineage which contain Haptophyta, diatoms and brown algae and are characterized by chlorophyll a ⁄ c The psbP gene is present in some of the algae in the red lineage but may...

11
501
0

Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot

Ngày tải lên : 28/03/2014, 15:20

... turbulence due to wave breaking on a natural beach To verify the accuracy of the numerical model on the simulation of the wave transformation on a natural beach, existing ... gradients of k and ε are assumed at the offshore, lateral boundaries and at surfaces of coastal structures. A scheme similar to that of Hibberd and Peregrine [5] is used to ... waves are breaking, a major part of the lost wave energy is dissipated directly in the shear layer beneath the surface roller, and only a minor part of it is transformed into turbulent ...

11
460
0

a novel method for the synthesis of titania nanotubes using

Ngày tải lên : 05/05/2014, 15:26

... lower the band gap of the titania S.K Mohapatra et al / Journal of Catalysis 246 (2007) 362–369 nanotubes, the better the activity for water-splitting Comparing the activity of the titania nanotubes ... compact (nanotubes are well attached to each other), and are one-dimensionally oriented (straight) than the nanotubes prepared by magnetic stirring [19] The formation mechanism of the TiO2 nanotubes ... compact nanotubes and the barrier layer The above experiments show that using ultrasonic waves for anodization can reduce the synthesis time by up to 50% and increase the length of the nanotubes...

8
634
0

a novel method for the synthesis of cao nanoparticle

Ngày tải lên : 06/05/2014, 08:55

... colloidal particles in water the high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, ... 2-CEPS, mL of final temperature of the oven was programmed isopropanol or heptane as solvent and 10 μL to 60 °C (held for min) and 220 °C, to reach the of toluene as internal standard and 5, 50, ... capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO [15 agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including...

12
705
0