lakes limnology and limnetic ecology towards a new synthesis

The Lakes Handbook VOLUME 1 LIMNOLOGY AND LIMNETIC ECOLOGY ppt

The Lakes Handbook VOLUME 1 LIMNOLOGY AND LIMNETIC ECOLOGY ppt

Ngày tải lên : 15/03/2014, 18:20
... Lakes and the Baltic Sea, the West Siberian Ice Lake, as 11 Origin of Lake Basins Paratethys Sea Desiccated Mediterranean Basin (a) Aral Sea Caspian Sea Carpathian Lake Black Sea Mediterranean Basin ... subsidiary fault scarps or other structural features may lead to is- 35 land formation They are not common and labelled as structural islands Olkhan Island and the small Ushkani Islands in Lake Baikal ... Victoria (Uganda, Kenya, Tanzania) Geneva (France, Switzerland) Lugano (Italy, Switzerland) Attersee (Austria) Biwa (Japan) Constance (i.e Bodensee Austria, Germany, Switzerland) Maggiore (Italy, Switzerland)...
  • 710
  • 532
  • 0
Five Year Strategic Plan (2011-2016) - Towards a New Dawn Ministry of Women and Child Development Government of India potx

Five Year Strategic Plan (2011-2016) - Towards a New Dawn Ministry of Women and Child Development Government of India potx

Ngày tải lên : 23/03/2014, 06:20
... of the Government, namely, National Rural Health Mission (NRHM), Sarva Shiksha Abhiyan (SSA), Total Sanitation Campaign (TSC) and Mahatma Gandhi National Rural Employment Guarantee Scheme (MGNREGS) ... 223 ABBREVIATIONS ANM Auxiliary Nurse Midwife ASHA Accredited Social Health Activist AWCs Anganwadi Centres AWW Anganwadi Worker AWH Anganwadi Helper BDO Block Development Officer CARA Central Adoption ... cruelty, maltreatment, abuse and sexual exploitation and are supported by a strong social safety net The Ministry aspires to facilitate access to culture and arts, recreation and play, leisure and...
  • 223
  • 354
  • 0
Tài liệu Film Cool: Towards a New Film Aesthetic ppt

Tài liệu Film Cool: Towards a New Film Aesthetic ppt

Ngày tải lên : 19/02/2014, 07:20
... essentially social historical dramas that find an ancestor in American realism and naturalism of the late nineteenth century I am not arguing here that all cinema was indebted to a realist aesthetic ... are necessarily abstract and tentatively bring together an analysis of The Matrix franchise and Quentin Tarantino’s brand of metacinema I focus on an aesthetics of cinema rather than its politics ... Gump and Scream have each received a significant amount of attention from film and cultural theorists), theory relegates an examination of popular cinema as far from a conventional aesthetic approach...
  • 221
  • 427
  • 0
Báo cáo khoa học: "TOWARDS A NEW TYPE OF ANALYSE " pptx

Báo cáo khoa học: "TOWARDS A NEW TYPE OF ANALYSE " pptx

Ngày tải lên : 09/03/2014, 01:20
... past and future), mood (indicative and imperative), and voice (active and passive) As concerns notation, usually several kinds of information are collapsed in a single abbreviation, cf K standing ... (which is an adjectival word-ending, ambiguous among nominative and accusative singular masculine-inanimate, and nominative singular masculine-animate, thus representing the adjectival "normal form,'), ... project of man-machine communication called TIBAQ (Text -and- Inference Based Answering of Questions, cf (Haji~ov@ and Sgall, 1981)) with no pre-arranged data base and with the capacity of self-enriching...
  • 8
  • 414
  • 0
Food and health in Europe: a new basis for action pdf

Food and health in Europe: a new basis for action pdf

Ngày tải lên : 16/03/2014, 14:20
... Denmark Estonia Finland France Georgia Germany Greece Hungary Iceland Ireland Israel Italy Kazakhstan Kyrgyzstan Latvia Lithuania Luxembourg Malta Monaco Netherlands Norway Poland Portugal Republic ... the particular health conditions of the countries it serves Member States Albania Andorra Armenia Austria Azerbaijan Belarus Belgium Bosnia and Herzegovina Bulgaria Croatia Czech Republic Denmark ... Greece Malta Italy Spain Portugal Israel France Switzerland Netherlands Germany United Kingdom Austria Belgium Sweden Denmark Norway Finland Yugoslavia Bulgaria Hungary Romania Slovakia Czech...
  • 38
  • 334
  • 0
Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt

Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt

Ngày tải lên : 23/03/2014, 09:20
... Coomassie Brilliant Blue (A) and the other was stained for activity using a- naphtyl acetate after renaturation (B) Lane M relative molecular mass standards; lane 1, cell free extract; lane 2, heat-stable ... 5¢-CA FEBS Journal 274 (2007) 2832–2842 ª 2007 The Authors Journal compilation ª 2007 FEBS M Levisson et al GTCACCTGGTAGTTACTGCCGCCGAAG-3¢, 5¢-CGAC GATCTCAATAACTTGATGATTTCAGG-3¢ and 5¢-CTC CTGAAATCATCAAGTTATTGAGATCGTCG-3¢, ... Quickchange (Stratagene) site-directed mutagenesis with the following primers 5¢-GT GCTGGGACACGCCCTCGGTGCGATGC-3¢ and 5¢-GC ATCGCACCGAGGGCGTGTCCCAGCAC-3¢, 5¢-GATCT TCGGCGGCAGAAACTACCAGGTGACTG-3¢ and...
  • 11
  • 460
  • 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Ngày tải lên : 23/03/2014, 17:22
... Serological methods Rabbit antisera against Citrobacter strains PCM 1531 and PCM 1487 were prepared as described previously [21] Passive haemagglutination and inhibition of passive haemagglutination ... Romanowska, A. , Gamian, A. , Witkowska, D., Katzenellenbogen, E & Romanowska, E (1994) Serological and structural features of Hafnia alvei lipopolysaccharides containing D-3hydroxybutyric acid ... Fuc and 3-substituted Rha in the molar ratio  : These data suggest that the OPS-I and OPS-II have an identical branched tetrasaccharide repeating unit It consists of the main chain containing...
  • 7
  • 478
  • 0
Food and health in Europe: a new basis for action pptx

Food and health in Europe: a new basis for action pptx

Ngày tải lên : 28/03/2014, 23:20
... Slovakia a TFYR Macedonia Hungary Croatia Bulgaria Kazakhstan Georgia Turkmenistan Albania Romania Azerbaijan Belarus Armenia Republic of Moldova Kyrgyzstan Uzbekistan 50 100 150 200 250 300 Availability ... Estonia Norway United Kingdom Poland Italy Romania Czech Republic Malta Denmark Latvia Portugal Ukraine Slovenia Bulgaria Russian Federation Slovakia Kyrgyzstan Spain Kazakhstan Turkmenistan Hungary ... both the total quantity eaten and the variety and choice have changed remarkably over the last 50 years Similar changes and differences apply to the availability of milk fat and fish (according...
  • 405
  • 635
  • 0
Báo cáo khoa học: Inhibition kinetics of catabolic dehydrogenases by elevated moieties of ATP and ADP – implication for a new regulation mechanism in Lactococcus lactis potx

Báo cáo khoa học: Inhibition kinetics of catabolic dehydrogenases by elevated moieties of ATP and ADP – implication for a new regulation mechanism in Lactococcus lactis potx

Ngày tải lên : 29/03/2014, 08:20
... the lactococcal dehydrogenases and ADH of yeast and horse liver as a function of the ATP and ADP pool Criterion for all data points chosen: [ATP] > [ADP] (A) Dehydrogenases from Lactococcus lactis ... 6-phosphate dehydrogenase by adenosine 5Â-triphosphate Proc Natl Acad Sci USA 56, 15431547 Nakamura M, Fujiwara A, Yasumasu I, Okinaga S & Arai K (1982) Regulation of glucose metabolism by adenine ... different manner than GAPDH Inhibition of LDH and ADH is competitive for ATP, ADP and AMP, whereas inhibition of GAPDH by ATP, ADP and AMP appeared to be mixed However, the high dissociation constants...
  • 10
  • 503
  • 0
WORLD INVESTMENT REPORT 2012 Towards a New GeNeraTioN of iNvesTmeNT Policies potx

WORLD INVESTMENT REPORT 2012 Towards a New GeNeraTioN of iNvesTmeNT Policies potx

Ngày tải lên : 30/03/2014, 12:20
... Bahrain, Liberia and Seychelles in Africa; and the Cook Islands, Maldives, the Marshall Islands, Nauru, Niue, Samoa, Tonga and Vanuatu in Asia; as well as economies in the Caribbean such as Anguilla, ... Denmark, Estonia, Finland, France, Germany, Greece, Hungary, Ireland, Israel, Italy, Japan, Latvia, Lithuania, Luxembourg, Malta, the Netherlands, New Zealand, Norway, Poland, Portugal, Romania, ... Anguilla, Antigua and Barbuda, Aruba, Barbados, Belize, the British Virgin Islands, the Cayman Islands, Dominica, Grenada, Montserrat, the Netherlands Antilles, Panama, Saint Kitts and Nevis, Saint...
  • 239
  • 483
  • 0
Economic and social development towards a sustainable direction in Van Lam Embroidery village (Ninh Hai, Hoa Lu, Ninh Binh)

Economic and social development towards a sustainable direction in Van Lam Embroidery village (Ninh Hai, Hoa Lu, Ninh Binh)

Ngày tải lên : 20/04/2014, 17:13
... chamois, and valuable birds (peafowl, parrots, hill minas, and cochins), and reptiles (pythons, snakes, varans, and tortoises) Beautiful and famous landscapes: The natural rocky mountain system in Van ... villages + By the number of trades: villages of a trade and villages of many trades + By nature of trades: Traditional trade villages and New trade villages * Traditional trade villages Basing ... but also conserves national cultural and historical values Developing economy and society in a sustainable way in trade villages is a new direction and a major challenge for many trade villages...
  • 28
  • 433
  • 0
Báo cáo hóa học: " Strong convergence theorems for equilibrium problems and fixed point problems: A new iterative method, some comments and applications" pptx

Báo cáo hóa học: " Strong convergence theorems for equilibrium problems and fixed point problems: A new iterative method, some comments and applications" pptx

Ngày tải lên : 21/06/2014, 01:20
... Republic of China Author details Department of Mathematics, Honghe University, Yunnan, 661100, China 2Department of Mathematics, National Kaohsiung Normal University, Kaohsiung 824, Taiwan Authors’ ... YF, Shang, MJ, Qin, XL: An iterative method of solution for equilibrium and optimization problems Nonlinear Anal 69, 2709–2719 (2008) doi:10.1016/j.na.2007.08.045 Tada, A, Takahashi, W: Weak and ... equilibrium problems and fixed point problems: A new iterative method, some comments and applications Fixed Point Theory and Applications 2011 2011:33 Submit your manuscript to a journal and benefit from:...
  • 15
  • 427
  • 0
Báo cáo khoa học: "Commissioning and early experience with a new-generation low-energy linear accelerator with advanced delivery and imaging functionalities" doc

Báo cáo khoa học: "Commissioning and early experience with a new-generation low-energy linear accelerator with advanced delivery and imaging functionalities" doc

Ngày tải lên : 09/08/2014, 09:21
... contribution AF and LC coordinated the study Data acquisition and data analysis were done by AC, EV, GN, AF The manuscript was prepared by LC and GN All authors read and approved the final manuscript ... for AAA can be found in Fogliata et al [6] In summary, the AAA configuration phase consisted in the optimisation of parameters and calculation kernels against the measured beam data The optimisation ... for beam characterisation and modelling into the treatment planning system, periodic quality assurance tests and RapidArc operations In all areas, UNIQUE resulted meeting specifications and having...
  • 29
  • 344
  • 0
báo cáo khoa học: " Identification and characterisation of CYP75A31, a new flavonoid 3’5’-hydroxylase, isolated from Solanum lycopersicum" pdf

báo cáo khoa học: " Identification and characterisation of CYP75A31, a new flavonoid 3’5’-hydroxylase, isolated from Solanum lycopersicum" pdf

Ngày tải lên : 12/08/2014, 03:21
... available); PAL5-F, 5’TTTCTCCATTACAAATCAAACCA-3’ and PAL5-R, 5’-TTCACTTCATCCAAATGACTCC-3’, CHS2 LOC778295 (7794); DFR LOC544150 (7795); FLS-F, 5’TAAGATTTGGCCTCCTCCTG-3’ and FLS-R, 5’ACCAAGCCCAAGTGATAAGC-3’; ... to make the primer 75ALerevECO (GGAATTCTCAGCAACGATAAACGTCCAAAGATAG) with an additional EcoRI site for the 3’ end of the gene The 5’ end primer, 75ALedirBAM (GGGATCCATGGCGTTACGTATTAATGAGTTATTT), ... 5’ACCAAGCCCAAGTGATAAGC-3’; F3H-F, 5’AGTGGTGAATTCGAATAGCAGTAG-3’ and F3H-R, 5’-TTTCCTCCTGTACATTTCTGCAA-3’; F3’H-F, 5’GAGGAGTTCAAGTTAATGGTGGT-3’ and F3’H-R, 5’-ACTCGCTTTTCCTTGTGTTCTT-3’; ANT1 (7793); JAF13-F,...
  • 12
  • 433
  • 0
Báo cáo y học: " G-CSF and IL-8 for early diagnosis of sepsis in neonates and critically ill children – safety and cost effectiveness of a new laboratory prediction model: study protocol of a randomized controlled trial [ISRCTN91123847]" pps

Báo cáo y học: " G-CSF and IL-8 for early diagnosis of sepsis in neonates and critically ill children – safety and cost effectiveness of a new laboratory prediction model: study protocol of a randomized controlled trial [ISRCTN91123847]" pps

Ngày tải lên : 12/08/2014, 20:20
... visual-analogue scales (range 0–100%) This documentation is again mandatory and must be marked on the laboratory form (Fig 1) In the intervention arm, blood or tracheal aspirate specimens are analyzed ... measurements of IL-8 and G-CSF and tracheal aspirate levels of G-CSF, employing a new laboratory method that allows simultaneous determination of parameters from 50 µl blood or tracheal aspirate ... Clinical data record form A trained study nurse collects all relevant clinical data for the day before and until days after collection of blood and/ or form tracheal aspirate for microbiological examination...
  • 8
  • 407
  • 0
Báo cáo y học: " Scaling, growth and cyclicity in biology: a new computational approach" ppsx

Báo cáo y học: " Scaling, growth and cyclicity in biology: a new computational approach" ppsx

Ngày tải lên : 13/08/2014, 16:21
... numerical tools and carried out the numerical analysis and the third CG has suggested and analyzed the applicative context of the paper Acknowledgements We wish to acknowledge the support of a Lagrange ... dimensionality and both input energy and metabolism are proportional to y In U2, as we have seen, the energy input term has a fractal dimensionality In U3, one more term with a fractal exponent, again ... al suggest a dynamical evolution of p in the transition from an avascular phase to an angiogenetic stage in tumors [13] Equation (7) may have (as in Refs [1] to [6]) a very simple energy balance...
  • 7
  • 229
  • 0
Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt

Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt

Ngày tải lên : 13/08/2014, 18:22
... 16) at t2 The Tanzanian and German board of the organization managing the orphanage gave their consent and ethical approval Materials The interview sets were basically identical for both assessments ... Childhood adversity, mental illhealth and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system Child and Adolescent ... at home and school in Tanzania [20] To date no prevalence rates for Tanzania are available [20], but Straus [17] reported that more than two thirds of Tanzanian students did not strongly disagree...
  • 9
  • 405
  • 0
mallaby - more money than god; hedge funds and the making of a new elite (2010)

mallaby - more money than god; hedge funds and the making of a new elite (2010)

Ngày tải lên : 01/11/2014, 21:26
... on his desk and a dictionary mounted on a stand There was a stock-exchange ticker with a glass dome over it, an electromechanical calculating machine that you cranked by hand, and a couch on which ... mortgage crash in 2007, Asness’s firm, AQR Capital Management, was running a remarkable $38 billion and Asness himself personified the new globe-changing finance He was irreverent, impatient, and scarcely ... hedge funds wreaked havoc with exchange-rate policies in Europe and Asia After the East Asian crisis, Malaysia’s prime minister, Mahathir Mohamad, lamented that “all these countries have spent 10...
  • 497
  • 380
  • 0
talani - the global crash; towards a new global financial regime (2010)

talani - the global crash; towards a new global financial regime (2010)

Ngày tải lên : 01/11/2014, 23:25
... The Stability and Growth Pact (co-authored) The Global Crash Towards a New Global Financial Regime? Leila Simona Talani 10.1057/9780230281530 - The Global Crash, Edited by Leila Simona Talani Copyright ... infinitesimally small probability and statistical distributions with fat tails that have become so fatal when the financial markets took a general downturn In the Keynesian/informational paradigm uncertainty ... create new financial products and later on gave a favourable rating to the same products Their incentives, instead of leading to the creation of sound and safe financial products, were skewed towards...
  • 209
  • 236
  • 0