kết 22 12 19 01
primate neuroethology mar 2010
... al., 199 7, 2000; Bertram & Chang, 2 001 ˆ D’Aout et al., 2002 Elftman, 194 4; Elftman & Manter, 193 5 Jenkins, 197 2 Kimura, 199 0, 199 1, 199 6 Larson & Stern, 198 6, 198 7 Larson et al., 199 1 Larson, 198 8, ... 198 0, 198 3, 198 8; Vilensky & Gankiewicz, 198 6, 199 0, Vilensky et al., 198 6, 199 0, 199 1 Whitehead & Larson, 199 4 Alexander & Maloiy, 198 4 Shapiro & Jungers, 198 8, 199 4 Anapol & Jungers, 198 7 Carlson ... Larson, 198 8, 198 9 Okada & Kondo, 198 2; Okada, 198 5 Prost, 196 7, 198 0 Shapiro et al., 199 7 Stern & Larson, 2 001 Stern & Susman, 198 1 Susman, 198 3 Swartz et al., 198 9 Tardieu et al., 199 3 Tuttle...
- 683
- 201
- 0
Tài liệu Health Education in Schools – The Importance of Establishing Healthy Behaviors in our Nation’s Youth pptx
... of Health, National; Heart, Lung, and Blood Institute; 199 8 NIH Publication No 98-4083 CDC Surveillance for Asthma – United States, 198 0 -199 9 In: CDC Surveillance Summaries, March 29, 2002 MMWR ... Brief #165 March 2007 Agency for Healthcare Research and Quality 12 Murphy KM, Topel, RH The Economic Value of Medical Research, 199 9 13 Ogden CL, Carroll MD, Curtin LR, McDowell MA, Tabak CJ, ... Overweight and Obesity: How Much, and Who’s Paying Health Affairs – Web Exclusive May 14, 2003; w3- 219 – w3 -226 15 Thorpe KE, Howard DH The Rise of Medicare Beneficiaries: The Role of Chronic Disease...
- 5
- 460
- 0
Health Education in Schools – The Importance of Establishing Healthy Behaviors in our Nation’s Youth pptx
... of Health, National; Heart, Lung, and Blood Institute; 199 8 NIH Publication No 98-4083 CDC Surveillance for Asthma – United States, 198 0 -199 9 In: CDC Surveillance Summaries, March 29, 2002 MMWR ... Brief #165 March 2007 Agency for Healthcare Research and Quality 12 Murphy KM, Topel, RH The Economic Value of Medical Research, 199 9 13 Ogden CL, Carroll MD, Curtin LR, McDowell MA, Tabak CJ, ... Overweight and Obesity: How Much, and Who’s Paying Health Affairs – Web Exclusive May 14, 2003; w3- 219 – w3 -226 15 Thorpe KE, Howard DH The Rise of Medicare Beneficiaries: The Role of Chronic Disease...
- 5
- 566
- 0
THE ROLE OF TRANSFORMATIONAL LEADERSHIP BEHAVIORS IN AFFECTIVE EMPLOYEE ENGAGEMENT AN EMPIRICAL STUDY IN THE TWO INDUSTRIES OF RETAIL AND FINANCIAL SERVICES IN HO CHI MINH CITY
... (Constant) 636 Std Error Beta t Sig Tolerance VIF 328 1.942 053 IIA -. 001 062 -. 001 -. 012 991 833 1. 201 IIB 166 062 129 2.661 008 908 1. 101 IS 145 054 130 2.699 007 913 1.095 IM -.062 069 -.045 -.897 ... -.030 058 -.025 -.525 600 833 1. 201 IIB 133 058 105 2.281 023 908 1. 101 IS 122 050 112 2.439 015 913 1.095 IM -.068 065 -.050 -1.045 297 828 1.208 IC 573 044 590 12. 915 000 915 1.093 From the table ... 249** 168** 348** 189** 016 042 N 320 320 Pearson Correlation IIA Sig (2-tailed) 000 003 000 001 320 320 320 320 203** 180** 249** 125 * 227 ** 134* 000 001 000 026 000 017 N 320 320 320 320 320...
- 84
- 510
- 1
Four essays on the economics of pro social behaviors
... giving, which is giving that is motivated by the See Kolm (196 9), Warr (198 2), Roberts (198 4), Bergstrom et al (198 6), and Andreoni (198 9, 199 0) pursuit of non-pecuniary private benefits accrued ... (8.107) 2.715 (6.236) -2.674 (8.091) 22. 222* ** (7.392) 16.809** (6.950) Gender if female if male 0.182 (8.055) 22. 850*** (7.458) 5.483 (8.384) -5.780 (7.889) 4.780 (7. 312) Nationality if local if others ... (7.637) 10.173 ( 7.516) 46.511*** ( 9.297) 59 0.0395 28.833*** ( 6.560) 62 0.2 019 52.111*** ( 8.981) 58 0.0 119 42. 412* ** (7.624) 64 0.1367 26.690** ( 7.103) 61 0.1104 Constant N R-Squared Notes:...
- 201
- 511
- 0
essays in behavioral economics in the context of strategic interaction
... -251.6 819 0.039 N/A 0.097 - 201. 5477 0.026 N/A 0.069 (0.055) [0.07,0.25] (0.038) [0.03,0 .19] (0.029) [0 .01, 0.15] 0.391 0. 401 0.742 0.711 0.416 0.428 (0.096) [0.25,0.55] (0.095) [0.55,0.85] (0. 101) ... sessions within a treatment yields p-values of 0. 101, 0.767 and 0.413 for A, B and C, respectively 20 pN RA [0 .01, 0.11] (0.038) [0 .01, 0.15] N/A [0 .01, 0.07] 0.383 0.368 0.703 0.648 0.416 0.403 (0.094) ... [0.37,0.67] 0.108 0.115 0.148 0.158 0.251 0.298 (0 .014 ) µ 0.114 [0.03,0.21] (0.099) pSRA 0.109 (0.061) [0.085,0.145] (0. 022) [0 .125 ,0.205] (0.054) [0 .195 ,0.445] log-lik pN RN +pN RA pN RN +pSRN 0.05...
- 145
- 370
- 0
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater
... Sludge Process RUN RUN1 RUN2 RUN3 RUN4 RUN5 RUN6 RUN DATE 2002 2003 10/18-11 /12 11 /12- 12/ 9-1/ 1/17-3/ 3/13-4/ 4/17-7/ 7/4-9/ 12/ 9 17 13 17 26 Real Coak Oven 5(%) 5 Wastewater Phenol 600(mg/L) 600 ... CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 199 5) was employed for the detection of Nitrobacter species, and the primer set NSR1113f CCTGCTTTCAGTTGCTACCG and NSR1264r GTTTGCAGCGCTTTGTACCG ... illlusterated in Figure The composition of the simulated coak oven wastewater is shown in Table./ 012 @A2 :;2?25 aerobic tank $%&'( mixing )'* tank +(+,-...
- 8
- 572
- 0
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model
... Management and Economics, 19, 511-518 June 27-28, 2 012 Cambridge, UK 20 2 012 Cambridge Business & Economics Conference ISBN : 9780974211428 Goetz, A M., & Gupta, R S (199 6) Who Takes the Credit? ... Chung, B (199 6) The view from the field: Perspectives from managers of microfinance institutions Journal of International Development,8, 179 -193 June 27-28, 2 012 Cambridge, UK 21 2 012 Cambridge ... groups shows that Group A has more possibilities for women entrepreneurship, June 27-28, 2 012 Cambridge, UK 12 2 012 Cambridge Business & Economics Conference ISBN : 9780974211428 because, culturally,...
- 23
- 552
- 0
CHAPTER 5 The Logic of Group Behavior In Business and Elsewhere
... Statistical Abstract of the United States: 199 3 (113th edition), Washington, DC, 199 3: p 401, table 636 21 Chapter The Logic of Group Behavior In Business and Elsewhere 22 claimant, there is little danger ... Street Journal, December 23, 199 3, p 39 See Susan Chandler, “United We Own.” Business Week March 18, 199 6, pp 96-100 40 Ibid., p 98 41 Ibid., p 99 42 In the WSJ on 24 June 199 7 was an article by Susan ... relationships between members and 12 Rosebeth M Kanter, Commitment and Community: Communes and Utopias in Sociological Perspective (Cambridge, Mass.: Harvard University Press, 197 3), p 64 Chapter The...
- 50
- 647
- 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
... marketing emerged in the late 196 0s and 197 0s from the work of Bagozzi (197 8), Kotler and Levy ( 196 9), Kotler and Zaltman (197 1), Rothschild ( 197 9), and Shapiro ( 197 3) Carrots, Sticks, and Promises ... with Skinner 193 5); evolutionary psychology (Dawkins 197 6; Wright 199 4); the evolution of cultures, norms, and conventions (Coleman 199 0; Young 199 6); neoclassical economics (Block 199 4; Hausmann ... marketing philosophy (Alderson 195 7; Hunt 197 6; Sheth Gardner, and Garrett 199 8), much of what has been called social marketing in the past has neglected the exchange (Andreasen 199 4) The functionalist...
- 14
- 780
- 0
Tài liệu The Basics of Social Marketing - How to Use Marketing to Change Behavior docx
... from a presentation by Peterson, E.A & Koehler, J.E (199 7) 199 7 Innovations in Social Marketing Conference Proceedings, pp 4-8 Background In 198 9, a severe form of diarrhea in African American ... Innovations in Social Marketing conference held in December 2002 ® 19 MORE RESOURCES FOR YOU Books on Social Marketing Andreasen, A.R (199 5) Marketing Social Change: Changing Behavior to Promote Health, ... Publications Siegel, M., M.D., and Doner, L (199 8) Marketing Public Health: Strategies to Promote Social Change Aspen Publishers, Inc Weinrich, N.K (199 9) Hands-on Social Marketing Thousand Oaks,...
- 25
- 605
- 0
Tài liệu STRATEGIC ENVIRONMENTAL ASSESSMENT on shrimp farms in the southeast of Thailand docx
... canals 11 Between 198 7 and 199 1 a major intensification of production took place in Thailand and the annual shrimp production rose by 615% (Flaherty and Karnjanakesort, 199 5) Since 199 0, cultivated ... a period of about eight months in 199 7 to 199 8, profits from the shrimp farms exploded (Rosenberry, 2 001) The shrimp industry in Thailand had a rough year in 199 6 due to impacts of shrimp disease, ... forests are situated in all 12 provinces in the south of Thailand In 35 years from 196 1- 199 6, about 50% of the mangrove forest was destroyed in the country (Platong, 199 8) The main causes for...
- 82
- 450
- 0
WORKING PAPER SERIES NO. 398 / OCTOBER 2004: MERGERS AND ACQUISITIONS AND BANK PERFORMANCE IN EUROPE THE ROLE OF STRATEGIC SIMILARITIES potx
... Model 0 .193 (0 .120 9) -0.264* (0.0534) 49.579* (3.739) 0.845 256.36 -0. 112 (0.1 312) -0.147+ (0.069) 0.002 (0.10) -0.820* (0.145) -0.033* (0.007) -0.0260+ (0.0 122 ) 3.072 (0.600) -6.231* (1. 401) 0.036* ... -1 .198 * (0.0274) -0.591* (0 .129 3) -1.216* (0.0252) -0.076* (0.009) 0.059* (0.0216) -0.067* (0 .010 ) 0 .017 (0.0068) -0.636* (0.155) 2.396* (0. 301) 0.005* (0.0008) -0.067* (0 .014 3) -0.004§ (0. 0014 ) ... 15.31 27.78 0.60 50.83 42 .01 0.38 12. 94 16.49 3.47 18.16 18 .22 0.81 22. 10 35.59 0.63 8.82 11.83 1.75 10.88 7.05 0.48 7.10 17 .19 0.43 13.28 15.89 6.13 24.03 36.11 1.15 128 .96 56.21 0.80 Note: The...
- 37
- 654
- 0
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
... Malaysia (198 0 – 2000) Inboard - Powered to 12 n.m 12 to 30 n m > 30 n.m to n m Year 198 0 198 1 198 2 198 3 198 4 198 5 198 6 198 7 198 8 198 9 199 0 199 1 199 2 199 3 199 4 199 5 199 6 199 7 199 8 199 9 2000 % ... 30, 922 30,669 199 9 199 8 29,765 199 7 30,258 30,363 199 6 33,433 199 5 199 4 30,744 32,382 199 3 37,403 199 2 38,213 199 1 39,594 199 0 41,782 198 9 198 8 37,487 198 7 38,792 38,815 198 6 43,778 198 5 198 4 ... 2.5: Oil Spill Incidents in Malaysia Waters Year (197 5 -199 7) Year Name of Ship Location Cause 197 5 197 5 197 6 197 6 197 6 197 7 197 8 197 9 198 0 198 1 198 4 198 6 SHOWA MARU TOLA SEA DIEGO SILANG MYSELLA...
- 88
- 581
- 0
Strategic Directions of the Department of Maternal, Newborn, Child and Adolescent Health ppt
... countdown 2015 mnch.org/documents/ 2010 report/CountdownReportAndProfiles.pdf) EB128/7 “Health-related Millennium Development Goals: Report by the Secretariat”, 30 December 2010 (http://apps who.int/gb/ebwha/pdf_files/EB128/B128_7-en.pdf) ... between 199 0 and 2015 , the proportion of people who suffer from hunger indicator 1.8: prevalence of underweight children under five years of age Target 4.A: Reduce by two-thirds, between 199 0 and 2015 , ... Health Organization 20 Avenue Appia, 121 1 Geneva 27, Switzerland Tel +41 22 791-3281 Fax +41 22 791-4853 Email mncah@who.int © World Health Organization 2011 ...
- 28
- 380
- 0
The National Road Map Strategic Plan To Accelerate Reduction of Maternal, Newborn and Child Deaths in Tanzania 2008 - 2015 potx
... Safe Motherhood Initiative (SMI) in 198 9, following the official launch of the Global Safe Motherhood Initiative in 198 7 in Nairobi, Kenya Subsequently, the 199 4 International Conference for Population ... Maternal Mortality ratio was 529/100,000 live births in TDHS 199 6 TDHS 2004/05 The National Road Map Strategic Plan -2008 - 2015 In 199 6 Tanzania adopted the Integrated Management of Childhood ... including the Baby Friendly Hospital Initiative (BFHI) in 199 2, the Code of Marketing Breast Milk Substitutes in 199 4 and Vitamin A Supplementation in 199 7 Tanzania developed its National Strategy on...
- 102
- 488
- 1
Báo cáo khoa học: X-ray crystallography, CD and kinetic studies revealed the essence of the abnormal behaviors of the cytochrome b5 Phe35fiTyr mutant pdf
... demonstrates the transitional CD curves of wild-type cyt b5 monitored at 222 nm, 299 nm, 398.4 nm and 418.8 nm The curves of 222 nm, 299 nm and 418.8 nm possess a similar pattern suggesting that ... Xia Z.X (199 9) Effect of mutation at valine 61 on the three-dimensional structure, stability, and redox potential of cytochrome b5 Biochemistry 38, 1196 1– 1197 2 Otwinowski, Z & Minor, W (199 7) Processing ... FEBS Lett 314, 419 422 Caffrey, M.S & Cusanovich, M.A (199 4) Site-specific mutagenesis studies of cytochrome c Biochim Biophys Acta 1187, 277– 288 Sandberg, W & Terwilliger, T (198 9) Influence of...
- 10
- 538
- 0
Division of the Chief Health Officer Strategic Directions for Mental Health Promotion 2009–2012 pptx
... Promotion 2009–2 012 Strategic Directions for Mental Health Promotion 2009–2 012 Strategic Directions for Quality Management 2009–2 012 Strategic Directions for Mental Health Promotion 2009–2 012 Division ... Prevention and Control 2009–2 012 Strategic Directions for Environmental Health 2009–2 012 Strategic Directions for HIV/AIDS, Hepatitis C and Sexual Health 2009–2 012 Strategic Directions for Injury ... the Chief Health Officer 2009– 2014 Strategic Directions for Cancer Prevention and Control 2009–2 012 Strategic Directions for Chronic Disease Prevention 2009–2 012 Strategic Directions for Communicable...
- 20
- 488
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25