kyphoplasty and vertebroplasty for the treatment of painful osteoporotic vertebral compression fractures

Tài liệu Bevacizumab and cetuximab for the treatment of metastatic colorectal cancer docx

Tài liệu Bevacizumab and cetuximab for the treatment of metastatic colorectal cancer docx

Ngày tải lên : 14/02/2014, 22:20
... from data in the RCT The survival of patients receiving ASC/BSC was calculated from the survival of the patients in the cetuximab monotherapy arm of the RCT The data from the monotherapy arm NICE ... guide for healthcare professionals Information for people with metastatic colorectal cancer and their carers (‘Understanding NICE guidance’) Details of all the evidence that was looked at and other ... evidence from the bevacizumab studies and noted that the age of the population in the largest study was lower than the age of patients normally receiving chemotherapy in England and Wales However,...
  • 34
  • 853
  • 0
Báo cáo y học: "Intra-articular hyaluronan (hyaluronic acid) and hylans for the treatment of osteoarthritis: mechanisms of action" pps

Báo cáo y học: "Intra-articular hyaluronan (hyaluronic acid) and hylans for the treatment of osteoarthritis: mechanisms of action" pps

Ngày tải lên : 09/08/2014, 01:21
... [70] and IL-1αinduced PGE2 production [71] in a dose- and MW-dependent manner; the higher the MW and concentration, the more potent the inhibition Intra-articular injection of HA in the temporomandibular ... levels of prostaglandin F2α, 6-keto-prostaglandin F1α, and leukotriene C4 [72] In synovial fluid from the knees of patients with OA and RA, intra-articular HA reduced the levels of PGE2 [73,74] and ... In the synovium of HA-treated knees, the number and aggregation of synoviocytes decreased, and both treatments reduced the number of inflammatory cells, including macrophages, lymphocytes, and...
  • 14
  • 409
  • 0
Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc

Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc

Ngày tải lên : 28/03/2014, 14:20
... evidence for the optimal period of treatment and number of treatments? We found evidence for the efficacy of shorter treatment protocols than the 4–6 months recommended by the ICS The basis of the ... the differences in outcome The expertise of health professionals may vary and also the quantity and quality of the educational information about the condition and PFM function The impact of these ... and other physical therapies for the treatment of female SUI [13] and UI [1416] has been the subject of previous systematic reviews All of these reviews limited their inclusion criteria to randomized...
  • 28
  • 738
  • 0
SYNTHESIZE AND INVESTIGATE THE CATALYTIC ACTIVITY OF THREE-WAY CATALYSTS BASED ON MIXED METAL OXIDES FOR THE TREATMENT OF EXHAUST GASES FROM INTERNAL COMBUSTION ENGINE

SYNTHESIZE AND INVESTIGATE THE CATALYTIC ACTIVITY OF THREE-WAY CATALYSTS BASED ON MIXED METAL OXIDES FOR THE TREATMENT OF EXHAUST GASES FROM INTERNAL COMBUSTION ENGINE

Ngày tải lên : 12/05/2014, 17:14
... choice and loading of the NM is a compromise between the required efficiency of the converter and the market price of the NM However, the application of noble metals for the treatment of exhaust ... are formed in adsorption of reactant molecules on the semi-conducting surface; the formation of these is a function of the electronic properties of the solid, and the structure and kind of bonds ... begins with the adsorption of CO and O2 on the Nguyen The Tien 29 Synthesize and investigate the catalytic activity of three-way catalysts based on mixed metal oxides for the treatment of exhaust...
  • 117
  • 376
  • 0
báo cáo hóa học:" Two levels above and one level below pedicle screw fixation for the treatment of unstable thoracolumbar fracture with partial or intact neurology" pot

báo cáo hóa học:" Two levels above and one level below pedicle screw fixation for the treatment of unstable thoracolumbar fracture with partial or intact neurology" pot

Ngày tải lên : 20/06/2014, 04:20
... extensive, and most spine surgeons advocate posterior fusion as the treatment of choice for unstable thoracolumbar injuries [4,5] The importance of early decompression and stabilization of unstable vertebral ... shown that when there is loss of more than 50% of the vertebral body height or angulations of the thoracolumbar junction of more than 20° [8], acute spinal instability results, and the spinal segment ... drafting the manuscript and designing of data and revising it critically, KCN has contributed in acquisition of data and analysis and interpretation of data, and JHY has contributed in acquisition and...
  • 6
  • 519
  • 1
Báo cáo y học: " Pregnancy and delivery while receiving vagus nerve stimulation for the treatment of major depression: a case report" pot

Báo cáo y học: " Pregnancy and delivery while receiving vagus nerve stimulation for the treatment of major depression: a case report" pot

Ngày tải lên : 08/08/2014, 21:20
... contraindication for enrollment in the VNS studies of patients with TRD, there have been no studies of the use of VNS therapy among pregnant patients A report of eight pregnancies in patients receiving VNS therapy ... Inc., collected the data for this pilot study and encouraged the authors to submit this case report to help increase the understanding of VNS therapy and pregnancy References Andersson L, Sundstrom-Poromaa ... DSM-IV diagnosis of unipolar depression, was enrolled in the acute and long-term phases of the pilot study of VNS therapy for TRD At acute-phase study entry, she was noted to be obese and to have...
  • 7
  • 453
  • 0
báo cáo khoa học: "Surgical perspectives from a prospective, nonrandomized, multicenter study of breast conserving surgery and adjuvant electronic brachytherapy for the treatment of breast cancer" pps

báo cáo khoa học: "Surgical perspectives from a prospective, nonrandomized, multicenter study of breast conserving surgery and adjuvant electronic brachytherapy for the treatment of breast cancer" pps

Ngày tải lên : 09/08/2014, 01:24
... skin, and an adequate skin bridge will maintain the distance from the balloon to the skin surface The greater the volume of the balloon, with the attendant compression of adjacent breast tissue, the ... eligibility criteria and were treated The majority of the 21 patients not eligible for treatment were disqualified at the time of implantation for inadequate balloon conformance to the tumor cavity ... help the patient meet the eligibility criteria Careful attention to the depth of the lesion from the skin using ultrasound measurements is needed for optimal design of the lumpectomy and the post-lumpectomy...
  • 10
  • 389
  • 0
Báo cáo khoa học: "Prior surgical intervention and tumor size impact clinical outcome after precision radiotherapy for the treatment of optic nerve sheath meningiomas (ONSM)" docx

Báo cáo khoa học: "Prior surgical intervention and tumor size impact clinical outcome after precision radiotherapy for the treatment of optic nerve sheath meningiomas (ONSM)" docx

Ngày tải lên : 09/08/2014, 09:21
... Kuhn and her team of technicians for excellent patient care Authors’ contributions SC, JD and SR treated the patients SA, SR and SC collected the data SC and SA evaluated the dataset and performed ... new headaches, and three of recurrent hyperlacrimation of the irradiated eye, one with change of taste perception None of the patients developed dysfunctions of the pituitary gland, neuropathy, ... returned in 32 out of the 40 patients (80%) The median age at the time of radiotherapy was 44 years (range 17-83 years) The tumor manifestation was on the right eye in 16 patients and on the left eye...
  • 6
  • 327
  • 0
Báo cáo khoa học: " Optimal organ-sparing intensity-modulated radiation therapy (IMRT) regimen for the treatment of locally advanced anal canal carcinoma: a comparison of conventional and IMRT plans" ppsx

Báo cáo khoa học: " Optimal organ-sparing intensity-modulated radiation therapy (IMRT) regimen for the treatment of locally advanced anal canal carcinoma: a comparison of conventional and IMRT plans" ppsx

Ngày tải lên : 09/08/2014, 10:21
... V20 of 59% and V10 of 73% It is possible that sparing of the femoral heads and/ or other organs comes at the cost of increasing dose to the iliac crests The results of our study reinforce the ... treatment The absolute BMS gain for the V20 is between 15 and 17%, with a V20 of 50.2% for arm A compared to 33, 32.8, and 34.3% for arms B, C, and D, respectively (all p < 0.05) The volume of ... conformation around the PTV Six and 18 MV photons were used for the AP and PA fields, respectively The radiation dose was prescribed to the PTV, such that 100% of the PTV received > 95% of the...
  • 11
  • 402
  • 0
báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot

báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot

Ngày tải lên : 10/08/2014, 10:21
... dexamethasone and rituximab, remaining in CR for 48 months He died at 73 years of age for sepsis during support therapy for t-MDS Other two patients have died: one for acute renal failure and one for ictus ... utilized in the majority of patients during FCR treatment, and in all of them after 90 Y-RIT Despite the high incidence of grade or neutropenia there were no patients requiring hospitalization for infection ... patients, specially at age of 60-75 and earlier in first relapse; further studies will help to clarify the best strategy for incorporating RIT into the treatment algorithm of these patients Abbreviations...
  • 5
  • 287
  • 0
Báo cáo y học: "A meta-analysis of CAG (cytarabine, aclarubicin, G-CSF) regimen for the treatment of 1029 patients with acute myeloid leukemia and myelodysplastic syndrome" ppsx

Báo cáo y học: "A meta-analysis of CAG (cytarabine, aclarubicin, G-CSF) regimen for the treatment of 1029 patients with acute myeloid leukemia and myelodysplastic syndrome" ppsx

Ngày tải lên : 10/08/2014, 21:23
... standards Therefore, the relapsed and refractory AML was still sensitive to alternative chemotherapy The CR rate of CAG (56.7%) for new AML appears to be slightly lower than the CR rate of standard ... study, we performed a systematic review and meta-analysis to assess the overall treatment efficacy and the adverse events of the CAG regimen Materials and Methods Data source The databases of PubMed, ... over the decade The toxicity data from this analysis may therefore overestimate the adverse events of the regimens under current health care system Majority of the studies were small (only of the...
  • 36
  • 714
  • 0
Báo cáo y học: "P38 MAP kinase inhibitors as potential therapeutics for the treatment of joint degeneration and pain associated with osteoarthritis" ppsx

Báo cáo y học: "P38 MAP kinase inhibitors as potential therapeutics for the treatment of joint degeneration and pain associated with osteoarthritis" ppsx

Ngày tải lên : 11/08/2014, 08:22
... models Therefore, the inhibition of proinflammatory cytokines may provide an important therapeutic approach for the treatment of OA Clinical trial data on cytokine inhibitors for the treatment of ... of Procter & Gamble Pharmaceuticals during the performance of these studies and received 100% of their compensation from the company Authors' contributions KKB, SAH and EBH performed all of the ... recorded and the final two were averaged to determine the response at the end of the study Statistical analysis The change of paw withdrawal latency (PWL) for vehicle and drug treatment groups in the...
  • 8
  • 461
  • 0
Báo cáo y học: "Anti-inflammatory effects of antidepressant and atypical antipsychotic medication for the treatment of major depression and comorbid arthritis: a case report" pdf

Báo cáo y học: "Anti-inflammatory effects of antidepressant and atypical antipsychotic medication for the treatment of major depression and comorbid arthritis: a case report" pdf

Ngày tải lên : 11/08/2014, 14:21
... three months of treatment Between the commencement of the new psychotropic treatment regimen in October 2007 and the significant improvement of the depressive symptoms as described above, the arthritis ... specific treatment (DMARDs and analgesics) had not changed While her CRP levels were 32 mg/L before the start of the new psychotropic treatment regimen, they dropped continuously to 13 mg/L Page of ... long before and after the clinical improvement This leaves us to the discussion of the anti-inflammatory effects of antipsychotic medication on CRP levels and a patient’s clinical symptoms The literature...
  • 4
  • 387
  • 0
Báo cáo khoa học: "Recombinant activated factor VIIa for the treatment of bleeding in major abdominal surgery including vascular and urological" doc

Báo cáo khoa học: "Recombinant activated factor VIIa for the treatment of bleeding in major abdominal surgery including vascular and urological" doc

Ngày tải lên : 13/08/2014, 10:20
... analysis and interpretation of the data, and drafting of the article SJ and CS contributed to the conception and design of the work, sampling of data, interpretation of the data, and revision of the ... article for content SZ contributed to the conception and design of the work, interpretation of the data, and revision of the article for content K-DW contributed to the analysis and interpretation of ... of the data, revision of the article for content, and approval of the version to be published DJ contributed to the conception and design of the work, sampling of data, interpretation of the...
  • 11
  • 370
  • 0
Báo cáo y học: "Atomoxetine for the treatment of Attention-Deficit/Hyperactivity Disorder (ADHD) in children with ADHD and dyslexia" pot

Báo cáo y học: "Atomoxetine for the treatment of Attention-Deficit/Hyperactivity Disorder (ADHD) in children with ADHD and dyslexia" pot

Ngày tải lên : 13/08/2014, 18:21
... after 4, 6, and 10 weeks of treatment, and at the end of the 16-week treatment period Electrocardiograms were collected at baseline, after weeks of treatment, and at discontinuation of the study ... weeks of treatment and continued to improve after and 16 weeks of treatment for both the ADHD and ADHD+D groups Improvements in mean reading comprehension standard scores and age equivalencies, and ... observed for any of the analyses http://www.capmh.com/content/3/1/40 Another key secondary objective evaluated performance on the WMTB-C For the ADHD group, the mean component and standard scores for...
  • 9
  • 827
  • 0
Báo cáo y học: " A multi-center, randomized, double-blind, parallel, placebo-controlled trial to evaluate the efficacy, safety, and pharmacokinetics of intravenous ibuprofen for the treatment of fever in critically ill and non-critically ill adults" pdf

Báo cáo y học: " A multi-center, randomized, double-blind, parallel, placebo-controlled trial to evaluate the efficacy, safety, and pharmacokinetics of intravenous ibuprofen for the treatment of fever in critically ill and non-critically ill adults" pdf

Ngày tải lên : 13/08/2014, 21:20
... received all six doses of the study drug, 28 of the 31 subjects (90%) in the 400 mg IV ibuprofen treatment group received all six doses of the study drug, and 23 of the 28 (82%) in the placebo group ... PW and MA made substantial contributions to the conception and design of the study, acquisition of data and the interpretation of data PM and PW drafted the manuscript and PM, JP, KG, PW and ... proportional for the 200 mg and 400 mg dose levels of IV Ibuprofen, see Table Figure demonstrates the mean plasma concentrations of ibuprofen for each of the three drug dosage arms in both the critically...
  • 13
  • 369
  • 0
design, synthesis, and biological evaluation of new anti-cancer nitrogen-containing combretastatins and novel cysteine protease inhibitors for the treatment of chagas

design, synthesis, and biological evaluation of new anti-cancer nitrogen-containing combretastatins and novel cysteine protease inhibitors for the treatment of chagas

Ngày tải lên : 14/11/2014, 11:32
... Cook and Andrea Johnson for all their help during these years My special gratitude to Mrs Beth Walker and other staff members at the office of the International Student and Scholar Services for ... because they are gaps in the cell cycle that come between the time of chromosome division and the time of chromosome replication The S stands for synthesis of DNA, and finally the division phase is ... cancer The treatment that is chosen depends on many different factors including the type of cancer, extent of the disease, rate of progression, condition of the patient and response to the therapy;...
  • 516
  • 254
  • 0
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique

Ngày tải lên : 26/10/2012, 09:32
... 100% relief of their pain in 86% of the patients with a median relief period of months The range of relief varied from zero days to up to 13 months for the facet injection group None of the lumbar ... median period of pain relief being months The range of relief for the radiofrequency group was from zero days to 16 months for all 26 patients who underwent the radiofrequency procedure Of the 14 patients ... incapable of re-innervating the joint In this study we investigate the long-term efficacy of facet debridement for the treatment of chronic back pain originating in the facet joint MATERIALS AND METHODS...
  • 4
  • 599
  • 0
Báo cáo y học: "Endoscopic thoracic laminoforaminoplasty for the treatment of thoracic radiculopathy: report of 12 case"

Báo cáo y học: "Endoscopic thoracic laminoforaminoplasty for the treatment of thoracic radiculopathy: report of 12 case"

Ngày tải lên : 26/10/2012, 09:57
... vascular and neural structures increases the risk of adverse events with invasive approaches Open surgical correction is the current standard of care for foraminal stenosis of cervical and lumbar ... Conflict of Interest The authors have declared that no conflict of interest exists References Kunogi J, Hasue M Diagnosis and operative treatment of intraforaminal and extraforaminal nerve root compression ... Pituitaries and kerrisons were then used to remove bulk tissues and bone to open up the spinal canal A standard burr with a 6mm bit was used to remove bone and smooth the bony edges of the opening...
  • 3
  • 506
  • 0
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater

Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater

Ngày tải lên : 05/09/2013, 09:38
... laboratory of UT at 4oCstored Then, each of the samples were divided into two One of them was for DNA extraction and was washed with TE buffer at pH8.0, and stored at -20oC Another was for FISH ... down the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the ... general, the higher concentration of primers can lead to the formation of primer dimers Also, the cost of the chemicals should be minimized if the same quantitativeness can be achieved The results...
  • 8
  • 572
  • 0