key elements of a plan
Family Life, Reproductive Health, and Population Education: Key Elements of a Health-Promoting School docx
Ngày tải lên :
22/03/2014, 12:20
... scope and amount of services that can be provided, the availability of trained staff, and the capacity to plan and evaluate efforts Knowing this information allows the team to draw on available ... Control and Prevention (CDC), Atlanta, USA Naomi Nhiwatiwa World Health Organization (WHO)/Regional Office for Africa, Harare, Zimbabwe Shanti Noriega-Minichiello World Health Organization (WHO)/Headquarters, ... Ministry of Health, Jakarta, Indonesia Robert Thomson World Health Organization (WHO)/Headquarters, Geneva, Switzerland Catharine Watson Straight Talk Foundation, Kampala, Uganda FAMILY LIFE, REPRODUCTIVE...
- 90
- 469
- 0
Tài liệu Elements of a PR Plan pptx
Ngày tải lên :
23/12/2013, 00:15
... or transparencies Press packages may include black-and-white photos and state that color material also is available via your Web site’s press section Audio Tapes for Radio Audio tapes are rarely ... becoming a major publicity tool as people take advantage of the Web’s multimedia capabilities Webcasts can be live events or archived and available on demand They are a cost-effective, instantaneous ... relations person is to facilitate the selection and training of an appropriate and available expert Media training can range from a brief 15-minute coaching session to two-day, videotaped seminars...
- 15
- 432
- 1
Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt
Ngày tải lên :
17/03/2014, 10:20
... 5¢-GAGTTTGGTTCGATGACAAGGAATGTTG-3¢ 5¢-GTTCGAGAACAATGAATGTTGTGTTC-3¢ 5¢-GAACACAACATTCTCTGTTCTCGAACC-3¢ 5¢-GAAGTTAAAGATACAATGATTCAGCTC 5¢-CATTGTTGAAGACATCAATGTTG-3¢ 5¢-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3¢ ... 5¢-GAGCTGAATCATTGTAACTTTAACTTC-3¢ 5¢-CAACATTGATGTCTTCAACAATG-3¢ 5¢-GCTGCAACATTGATGAATTCAACAATGTAAAG-3¢ 5¢-CTGCAACATTAGCGTTTTCAACAATG-3¢ 5¢-CATACGGAGCATGAGGGTTTCCTTG-3¢ 5¢-CGGGATCGCCATTTCGAGACGGAGGG-3¢ ... 5¢-TCCGTATGGCGGCTCCGCTTCTAGTC-3¢ 5¢-TCCGTATGGCGAAACCGCTTCTAGTC-3¢ 5¢-GATACCGATGAGATGGGTGGGCAGTTTAG-3¢ 5¢-CAACATTCCTTGTCATCGAACCAAACTC-3¢ 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢ 5¢-GGTTCGAGAACAGAGAATGTTGTGTTC-3¢ 5¢-GAGCTGAATCATTGTAACTTTAACTTC-3¢...
- 12
- 380
- 0
CFD for hydrodynamic efficiency and design optimization of key elements of SHP
Ngày tải lên :
05/09/2013, 14:58
... flow behavior and regulate the pressure are also analyzed Mathematical approach Although the Navier-Stokes equations have a limited number of known analytical solutions, they are adequate for ... unfavorable hydrodynamic impact on the operation and performance of turbines, and can cause dangerous hydropneumatic effects, such as noise and vibrations 1.4 Draft tube and tailrace Another challenge ... fraction values decrease again towards downstream and the density values of the mixture of water vapor, other dissolved gases and water increase again in the same direction Both the water vapor...
- 16
- 490
- 0
Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc
Ngày tải lên :
14/02/2014, 14:20
... N-Pro 208 aa 34 aa CT - ex Stop 114 aa Xho1 365 aa 24 aa 208 aa N-Pro N Pro II 24 aa Protease domain BamH H1 Start I 114 aa Pre A S Dutta et al Protease domain CT - ex 34 aa III 208 aa N-Pro NP ... protease from the latex of Ervatamia coronaria Biosci Biotechnol Biochem 62, 1947–1955 15 GuhaThakurta P, Biswas S, Chakrabarti C, Sundd M, Jagannadham MV & Dattagupta JK (2004) Structural basis of ... proteases [Erv -A, -B and –C (isolated from the latex of Ervatamia coronaria in our laboratory) and papain from Carica papaya (Merck, Kenilworth, NJ, USA)], two serine proteases [trypsin and chymotrypsin...
- 13
- 759
- 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
Ngày tải lên :
16/02/2014, 09:20
... values increase from G1P over PhyK to AppA by a factor of 2200 The conformational changes of AppA upon substrate binding facilitate a faster turnover of phytate and are in line with a higher specificity ... site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) Plasmid pET-1TK was used as template and Kleb(HtoA)fw (5¢-GCTTAGCCGCGCCGGCATTCG) and Kleb(HtoA)rv (5¢-CGAATGCCGGCGCGGCTAAGC) as primers ... conserved active-site motifs, RHGXRXP and HD, and hydrolyze metal-free phytate with pH optima in the acidic range They consist of two domains, a large a ⁄ b domain and a small a domain with the catalytic...
- 13
- 766
- 0
Báo cáo khoa học: Purification of a plant nucleotide pyrophosphatase as a protein that interferes with nitrate reductase and glutamine synthetase assays pdf
Ngày tải lên :
08/03/2014, 08:20
... percent of the amount of NADH used in our standard NR assay, and 60% of the amount of ATP in a GS assay, was converted into AMP within 10 at 30 °C by an amount of a Mono Q fraction that appeared ... trichloroacetic acid The A5 04 was measured and the c-glutamyl hydroxamate produced was quantified using commercial c-glutamyl hydroxamate as standard Control assays were performed in the absence of ATP ... in a 100-lL incubation at 30 °C for 10 min, using the amounts and concentrations of ATP and NADH used in standard GS and NR assays, respectively Data are presented as mean ± SEM Cofactor AMP...
- 7
- 457
- 0
Báo cáo lâm nghiệp: " Influence of a planting hole application of dolomitic limestone powder and basalt grit on the growth of Carpathian birch (Betula carpatica W. et K.) and soil chemistry in the air-polluted Jizerské hory Mts." pptx
Ngày tải lên :
07/08/2014, 10:22
... optimal The material was, however, a waste of a local quarry and there was a request for its testing as a cheap environmentally-friendly basic amendment at that time A scaled rod was used to measure ... the Spekol 210 apparatus, plant available Ca and Mg by AAS (Atomic Absorption Spectroscopy) The samples of assimilatory tissues and soil samples were analyzed at the Tomáš Laboratory using the ... that approximately 15 to 20 cores were taken within a particular treatment variant A core is considered as a subsample of soil taken with a soil corer (3 cm in diameter) from the space of a planting...
- 11
- 406
- 0
báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx
Ngày tải lên :
11/08/2014, 11:21
... Author details Departamento de Bioquímica, Biolog a Celular y Molecular de Plantas, Estación Experimental del Zaidín (CSIC), Profesor Albareda 1, 18008, Granada, Spain 2Department of Cell Biology, ... electron-dense matrix of the exudates (arrowheads) (E) In the stigma of a flower without petals and anthers (stage 5), Ca/Sb deposits are less abundant and present mainly on the surface of degenerating papillae ... maximal values just after anther dehiscence (stage 4) At the latest analyzed stage (stage 5) a significant decrease of Ca2+ levels was observed in the upper parts of the pistil (stigma and style)...
- 12
- 529
- 0
A CFD analysis on the effect of ambient conditions on the hygro-thermal stresses distribution in a planar ambient airbreathing PEM fuel cell
Ngày tải lên :
05/09/2013, 14:58
... hydration and avoidance of water flooding in the cathode catalyst layer and/or gas diffusion layer [2] Water management is related with air supply to the cathode and is one of the crucial factors in an ... computational fluid dynamics model of a planar air-breathing PEM fuel cell has been developed and used to investigate the cell at varying ambient temperature and relative humidity Detailed analyses ... Computational domain The full computational domains for the planar air-breathing PEM fuel cell consists of anode gas flow field and the membrane electrode assembly is shown in Figure ( 1a) A schematic...
- 16
- 727
- 0
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
Ngày tải lên :
24/12/2013, 01:17
... parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent table ... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... is a row in the Orders table that also has a CustomerID of J6COM A copy of this row is stored in a DataTable named ordersDT The customersDT and ordersDT DataTable objects are related to each...
- 6
- 428
- 0
Tài liệu THE ELEMENTS OF BACTERIOLOGICAL TECHNIQUE A LABORATORY GUIDE FOR MEDICAL, DENTAL, AND TECHNICAL STUDENTS pptx
Ngày tải lên :
16/02/2014, 22:20
... bacteriological laboratory, so far as the glass apparatus is concerned, differs but little from that of a chemical laboratory, and the cleanliness of the apparatus is equally important The glassware comprised ... EXPERIMENTAL ANIMALS 396 XX THE STUDY OF THE PATHOGENIC BACTERIA 408 XXI BACTERIOLOGICAL ANALYSES 415 Bacteriological Examination of Water, 416—Examination of Milk, 441—Ice Cream, 457—Examination of ... Cream and Butter, 457—Examination of Unsound Meats, 460—Examination of Oysters and Other Shellfish, 463—Examination of Sewage and Sewage Effluents, 466—Examination of Air, 468—Examination of...
- 666
- 511
- 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
Ngày tải lên :
19/02/2014, 05:20
... oxyheme appeared at 540 and 579 nm Then, a broad band appeared at around 660 nm, and was maximal 9–12 after initiation of the reaction The spectral features of the final reaction mixture were analogous, ... absorption bands Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands of verdoheme ... the formation of CO–verdoheme The 637 nm band disappeared gradually and was replaced by a new broad band with a maximum at approximately 675 nm, identical to the absorption band of free biliverdin...
- 16
- 617
- 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
Ngày tải lên :
20/02/2014, 01:20
... (Mannheim, Germany) Ethanol (> 99%) was obtained from Panreac (Barcelona, Spain) Urea was a product of Acros (Pittsburgh, PA, USA) The QuickchangeTM kit containing Pfu DNA polymerase, 10 · reaction ... conformation of denatured proteins Here we show that a specific single mutation or removal of a specific fragment can cause large changes in the native state of SNase Fig Steady-state fluorescent spectra of ... 50 mm NaHPO4 ⁄ 200 mm NaCl, pH adjusted to 7.0) at a concentration of 0.5 mgÆmL)1 Spectra were obtained as the average of five successive scans with a bandwidth of 1.0 nm and a scan speed of 20...
- 7
- 551
- 0
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf
Ngày tải lên :
20/02/2014, 11:20
... T9 6A F10 0A V12 6A F12 8A S12 9A E13 0A V13 1A E13 2A R13 3A R13 5A F13 6A I13 7A I13 8A N13 9A D14 0A W14 1A V14 2A K14 3A T14 4A H14 5A T14 6A K14 7A M14 9A N15 2A E28 3A E28 5A K32 5A K32 7A PAI-1stab PAI-1stab(E28 5A) ... SDS/PAGE analysis After 24 h, the fraction of molecules behaving as a substrate for uPA decreased approximately twofold for PAI-1(V12 6A) , PAI-1(F10 0A) , PAI-1(F12 8A) and PAI-1(W14 1A) with a concomitant ... rate of latency transition expressed as the functional half-life, t½ The averages and standard deviations for at least three independent measurements are given for each variant PAI-1 variant Activity...
- 9
- 605
- 0
The impact of a cancer Survivorship Care Plan on gynecological cancer patient and health car provider reported outcomes (ROGY Care): study protocol for a pragmatic cluster randomized controlled trial potx
Ngày tải lên :
05/03/2014, 15:20
... demographic and socioeconomic variables such as age, education, marital status, and employment status, and clinical variables such as cancer stage at diagnosis, time after diagnosis, and initial ... information that is congruent with a patient’s needs at that particular time is an important determinant for patient satisfaction and affects health-related quality of life (HRQoL) and anxiety and ... usual care group with that of the SCP approach by giving a patient randomized to usual care more information than was intended for usual care Also, if usual care patients learn from other patients...
- 8
- 786
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
Ngày tải lên :
06/03/2014, 01:20
... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS ... localization of HDAC4 orchestrates muscle differentiation Nucleic Acids Res 29, 3439–3447 22 Yasuhara N, Shibazaki N, Tanaka S, Nagai M, Kamikawa Y, Oe S, Asally M, Kamachi Y, Kondoh H & Yoneda...
- 12
- 454
- 0
Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf
Ngày tải lên :
07/03/2014, 11:20
... were made with PYMOL [47] able sequences, some bacterial family 19 chitinases have catalytic domains that are at least as large as those of the plant enzymes and that may contain at least six ... Haemophilus influenzae, and Pseudomonas aeruginosa Although many plant family 19 chitinases are known, crystal structures are available for only two of these [9,15–17] The first structure of a ... role of these glutamates was demonstrated by site-directed mutagenesis Table shows that all mutants had greatly reduced catalytic activity Some detectable activity was still left upon mutation of...
- 12
- 399
- 0